ID: 1039026836

View in Genome Browser
Species Human (GRCh38)
Location 8:33267756-33267778
Sequence TATACAGGGTTCTGTACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039026836_1039026839 9 Left 1039026836 8:33267756-33267778 CCAATGGTACAGAACCCTGTATA No data
Right 1039026839 8:33267788-33267810 TCCCTGTACATACATACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039026836 Original CRISPR TATACAGGGTTCTGTACCAT TGG (reversed) Intergenic
No off target data available for this crispr