ID: 1039030149 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:33299803-33299825 |
Sequence | AGGGAGAATCAGGAAGTGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039030149_1039030155 | 24 | Left | 1039030149 | 8:33299803-33299825 | CCAACCACTTCCTGATTCTCCCT | No data | ||
Right | 1039030155 | 8:33299850-33299872 | TAAAAATGAGAACTCCTTGCAGG | No data | ||||
1039030149_1039030156 | 27 | Left | 1039030149 | 8:33299803-33299825 | CCAACCACTTCCTGATTCTCCCT | No data | ||
Right | 1039030156 | 8:33299853-33299875 | AAATGAGAACTCCTTGCAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039030149 | Original CRISPR | AGGGAGAATCAGGAAGTGGT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |