ID: 1039030149

View in Genome Browser
Species Human (GRCh38)
Location 8:33299803-33299825
Sequence AGGGAGAATCAGGAAGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039030149_1039030155 24 Left 1039030149 8:33299803-33299825 CCAACCACTTCCTGATTCTCCCT No data
Right 1039030155 8:33299850-33299872 TAAAAATGAGAACTCCTTGCAGG No data
1039030149_1039030156 27 Left 1039030149 8:33299803-33299825 CCAACCACTTCCTGATTCTCCCT No data
Right 1039030156 8:33299853-33299875 AAATGAGAACTCCTTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039030149 Original CRISPR AGGGAGAATCAGGAAGTGGT TGG (reversed) Intergenic
No off target data available for this crispr