ID: 1039032168

View in Genome Browser
Species Human (GRCh38)
Location 8:33322338-33322360
Sequence GCTCAAGGCTGGTGCATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039032168_1039032175 25 Left 1039032168 8:33322338-33322360 CCCATGATGCACCAGCCTTGAGC No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data
1039032168_1039032174 24 Left 1039032168 8:33322338-33322360 CCCATGATGCACCAGCCTTGAGC No data
Right 1039032174 8:33322385-33322407 TTGCTGAGTGTAGCTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039032168 Original CRISPR GCTCAAGGCTGGTGCATCAT GGG (reversed) Intergenic
No off target data available for this crispr