ID: 1039032169

View in Genome Browser
Species Human (GRCh38)
Location 8:33322339-33322361
Sequence AGCTCAAGGCTGGTGCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039032169_1039032174 23 Left 1039032169 8:33322339-33322361 CCATGATGCACCAGCCTTGAGCT No data
Right 1039032174 8:33322385-33322407 TTGCTGAGTGTAGCTCTACAAGG No data
1039032169_1039032175 24 Left 1039032169 8:33322339-33322361 CCATGATGCACCAGCCTTGAGCT No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039032169 Original CRISPR AGCTCAAGGCTGGTGCATCA TGG (reversed) Intergenic