ID: 1039032172

View in Genome Browser
Species Human (GRCh38)
Location 8:33322349-33322371
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039032172_1039032175 14 Left 1039032172 8:33322349-33322371 CCAGCCTTGAGCTTAATAGGGAG No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data
1039032172_1039032176 26 Left 1039032172 8:33322349-33322371 CCAGCCTTGAGCTTAATAGGGAG No data
Right 1039032176 8:33322398-33322420 CTCTACAAGGGCCCTGAGCTTGG No data
1039032172_1039032174 13 Left 1039032172 8:33322349-33322371 CCAGCCTTGAGCTTAATAGGGAG No data
Right 1039032174 8:33322385-33322407 TTGCTGAGTGTAGCTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039032172 Original CRISPR CTCCCTATTAAGCTCAAGGC TGG (reversed) Intergenic