ID: 1039032173

View in Genome Browser
Species Human (GRCh38)
Location 8:33322353-33322375
Sequence CATGCTCCCTATTAAGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039032173_1039032174 9 Left 1039032173 8:33322353-33322375 CCTTGAGCTTAATAGGGAGCATG No data
Right 1039032174 8:33322385-33322407 TTGCTGAGTGTAGCTCTACAAGG No data
1039032173_1039032176 22 Left 1039032173 8:33322353-33322375 CCTTGAGCTTAATAGGGAGCATG No data
Right 1039032176 8:33322398-33322420 CTCTACAAGGGCCCTGAGCTTGG No data
1039032173_1039032175 10 Left 1039032173 8:33322353-33322375 CCTTGAGCTTAATAGGGAGCATG No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039032173 Original CRISPR CATGCTCCCTATTAAGCTCA AGG (reversed) Intergenic
No off target data available for this crispr