ID: 1039032175

View in Genome Browser
Species Human (GRCh38)
Location 8:33322386-33322408
Sequence TGCTGAGTGTAGCTCTACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039032169_1039032175 24 Left 1039032169 8:33322339-33322361 CCATGATGCACCAGCCTTGAGCT No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data
1039032168_1039032175 25 Left 1039032168 8:33322338-33322360 CCCATGATGCACCAGCCTTGAGC No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data
1039032172_1039032175 14 Left 1039032172 8:33322349-33322371 CCAGCCTTGAGCTTAATAGGGAG No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data
1039032173_1039032175 10 Left 1039032173 8:33322353-33322375 CCTTGAGCTTAATAGGGAGCATG No data
Right 1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039032175 Original CRISPR TGCTGAGTGTAGCTCTACAA GGG Intergenic
No off target data available for this crispr