ID: 1039032176

View in Genome Browser
Species Human (GRCh38)
Location 8:33322398-33322420
Sequence CTCTACAAGGGCCCTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039032173_1039032176 22 Left 1039032173 8:33322353-33322375 CCTTGAGCTTAATAGGGAGCATG No data
Right 1039032176 8:33322398-33322420 CTCTACAAGGGCCCTGAGCTTGG No data
1039032172_1039032176 26 Left 1039032172 8:33322349-33322371 CCAGCCTTGAGCTTAATAGGGAG No data
Right 1039032176 8:33322398-33322420 CTCTACAAGGGCCCTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039032176 Original CRISPR CTCTACAAGGGCCCTGAGCT TGG Intergenic