ID: 1039035989

View in Genome Browser
Species Human (GRCh38)
Location 8:33359920-33359942
Sequence TGCTTACACCCGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039035983_1039035989 8 Left 1039035983 8:33359889-33359911 CCAGTTCCTCAGGAGGCTGAGAC No data
Right 1039035989 8:33359920-33359942 TGCTTACACCCGGGAGGCGGAGG No data
1039035982_1039035989 9 Left 1039035982 8:33359888-33359910 CCCAGTTCCTCAGGAGGCTGAGA No data
Right 1039035989 8:33359920-33359942 TGCTTACACCCGGGAGGCGGAGG No data
1039035984_1039035989 2 Left 1039035984 8:33359895-33359917 CCTCAGGAGGCTGAGACAAGAGA No data
Right 1039035989 8:33359920-33359942 TGCTTACACCCGGGAGGCGGAGG No data
1039035980_1039035989 17 Left 1039035980 8:33359880-33359902 CCTGTAATCCCAGTTCCTCAGGA 0: 17
1: 2062
2: 62482
3: 156162
4: 270307
Right 1039035989 8:33359920-33359942 TGCTTACACCCGGGAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039035989 Original CRISPR TGCTTACACCCGGGAGGCGG AGG Intergenic
No off target data available for this crispr