ID: 1039045907

View in Genome Browser
Species Human (GRCh38)
Location 8:33449200-33449222
Sequence CTGTGGGCACTGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039045903_1039045907 26 Left 1039045903 8:33449151-33449173 CCTGATATACAGTACTCAATGAA 0: 1
1: 0
2: 1
3: 22
4: 168
Right 1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039045907 Original CRISPR CTGTGGGCACTGAGAGAAGA AGG Intronic
No off target data available for this crispr