ID: 1039053393

View in Genome Browser
Species Human (GRCh38)
Location 8:33514690-33514712
Sequence CTAAATGGAAGCAGCTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039053393_1039053401 23 Left 1039053393 8:33514690-33514712 CCCGAGGAGCTGCTTCCATTTAG No data
Right 1039053401 8:33514736-33514758 CACGGTTTCGCAGGAGCCCGAGG No data
1039053393_1039053398 5 Left 1039053393 8:33514690-33514712 CCCGAGGAGCTGCTTCCATTTAG No data
Right 1039053398 8:33514718-33514740 TGTGACTCTCATAGCTTCCACGG No data
1039053393_1039053399 14 Left 1039053393 8:33514690-33514712 CCCGAGGAGCTGCTTCCATTTAG No data
Right 1039053399 8:33514727-33514749 CATAGCTTCCACGGTTTCGCAGG No data
1039053393_1039053402 26 Left 1039053393 8:33514690-33514712 CCCGAGGAGCTGCTTCCATTTAG No data
Right 1039053402 8:33514739-33514761 GGTTTCGCAGGAGCCCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039053393 Original CRISPR CTAAATGGAAGCAGCTCCTC GGG (reversed) Intergenic
No off target data available for this crispr