ID: 1039056389

View in Genome Browser
Species Human (GRCh38)
Location 8:33540468-33540490
Sequence CTCTGGACAAGTGGCAGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039056383_1039056389 -10 Left 1039056383 8:33540455-33540477 CCCAGTCATGGCCCTCTGGACAA No data
Right 1039056389 8:33540468-33540490 CTCTGGACAAGTGGCAGGTCCGG 0: 1
1: 0
2: 1
3: 12
4: 186
1039056379_1039056389 17 Left 1039056379 8:33540428-33540450 CCAGATAGCTGCAGGGTCAAGTA 0: 1
1: 0
2: 0
3: 19
4: 66
Right 1039056389 8:33540468-33540490 CTCTGGACAAGTGGCAGGTCCGG 0: 1
1: 0
2: 1
3: 12
4: 186
1039056382_1039056389 -9 Left 1039056382 8:33540454-33540476 CCCCAGTCATGGCCCTCTGGACA No data
Right 1039056389 8:33540468-33540490 CTCTGGACAAGTGGCAGGTCCGG 0: 1
1: 0
2: 1
3: 12
4: 186
1039056378_1039056389 18 Left 1039056378 8:33540427-33540449 CCCAGATAGCTGCAGGGTCAAGT 0: 1
1: 0
2: 0
3: 22
4: 132
Right 1039056389 8:33540468-33540490 CTCTGGACAAGTGGCAGGTCCGG 0: 1
1: 0
2: 1
3: 12
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039056389 Original CRISPR CTCTGGACAAGTGGCAGGTC CGG Intergenic
900149419 1:1171648-1171670 CTCAGGTCAGGTGGCAGGTGGGG - Intergenic
901163478 1:7198337-7198359 GTCAGGACCAGTGACAGGTCGGG - Intronic
902368498 1:15991875-15991897 CTCTGGCCCAGAGGGAGGTCTGG + Intergenic
902412618 1:16220300-16220322 CTCTGGACAAAGGGCAGAGCTGG + Intergenic
905655178 1:39682298-39682320 TTCTGGCCAAGTGGGAGGTGGGG + Exonic
905799470 1:40834143-40834165 CTTGGGTCAGGTGGCAGGTCAGG - Intronic
906510147 1:46406062-46406084 CTATGGACAGGAGGCAGGTGAGG + Exonic
908398620 1:63749395-63749417 GTCTGGTCTAGTGGCAGGTGTGG + Intergenic
913576006 1:120176055-120176077 CTCTGGAGAAGTGGTAGCTTTGG - Intronic
916070714 1:161168122-161168144 CTCTGGGCAAGTGTCACCTCAGG - Exonic
917453480 1:175166430-175166452 TTCTGGACAATTGTCAGGTTTGG + Intronic
921278738 1:213544716-213544738 CAGTGCAGAAGTGGCAGGTCAGG - Intergenic
922317706 1:224457110-224457132 CTCAGGACAGCAGGCAGGTCAGG + Intronic
922797075 1:228345496-228345518 GTCTGGACAGGTGGCAGGAGGGG - Intronic
924707553 1:246511839-246511861 CTCTGGCCCAGGGGGAGGTCTGG - Intergenic
924942075 1:248818872-248818894 CTCTGGACAGGAGGCTGGACAGG + Intronic
1064004885 10:11691659-11691681 CTCTGCACATGTGGCATGTGTGG + Intergenic
1068631252 10:59300140-59300162 CTCGGGTCAAGTGCCAGCTCTGG + Intronic
1068995521 10:63198121-63198143 CTCTGGATATCAGGCAGGTCTGG - Intronic
1075270770 10:121048271-121048293 CTCTGGAAAAGGGGGAGGGCAGG + Intergenic
1075402879 10:122173502-122173524 CTCGTGACAAGTGCCAGATCTGG - Intronic
1076170681 10:128317190-128317212 TTCTGGTCATGTGACAGGTCTGG + Intergenic
1078428764 11:11271354-11271376 CTCAGGCCAAGTGGCTGGTGAGG + Intronic
1081611515 11:44565834-44565856 CTCGGAACTAGTGACAGGTCGGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084770820 11:71341869-71341891 CTCTGGACAAATCTCAGGTGAGG + Intergenic
1085723365 11:78932690-78932712 CCATGGACCAGTGGCAGGTGGGG + Intronic
1088460380 11:110076228-110076250 CTCTGGACAAGGGGCGCCTCTGG - Intergenic
1089015938 11:115165310-115165332 CTCTGCCTACGTGGCAGGTCTGG + Intergenic
1090879517 11:130821284-130821306 CTCTGGGCTAGTGGAAGGTTGGG - Intergenic
1098465866 12:70784485-70784507 CTCCGGACAAGGGGGAGCTCTGG - Intronic
1098987400 12:77027487-77027509 TTGTGGCCAAGTGCCAGGTCTGG - Intronic
1099394083 12:82116789-82116811 CTCTGGATGAGGGTCAGGTCTGG - Intergenic
1104155431 12:126126637-126126659 CTATGGACCAGTGTCAAGTCAGG + Intergenic
1104720400 12:131042101-131042123 CTGTGGGCAAGTGGCAGCTGGGG - Intronic
1104764284 12:131316348-131316370 CTCAGGGCCAGAGGCAGGTCTGG - Intergenic
1104836748 12:131796552-131796574 CGGCGGACAACTGGCAGGTCAGG + Intronic
1107719874 13:43236957-43236979 CTCTGCACAAGTGGCAAATTTGG + Intronic
1108245191 13:48506604-48506626 CGCTGGTCAGGTGGCAGGTGTGG + Intronic
1108472835 13:50784675-50784697 CTAGGGAGAAGTGGCAGGTCAGG - Intronic
1110780169 13:79456078-79456100 CTTTGGTCTAGTGGCAAGTCTGG - Intergenic
1112382779 13:98908560-98908582 CTCTGGGCCAGTGGAAGATCTGG - Intronic
1113956008 13:114100066-114100088 CTCTGGAAGAGCGGCAGGCCAGG + Intronic
1116414149 14:44660403-44660425 ATCTGGACAGGTGGGAGGTGGGG - Intergenic
1120981464 14:90292799-90292821 CTCTGCCCAGGTGGCAGATCTGG - Exonic
1121543147 14:94743525-94743547 CTCTGGACCTGGGGCAGGTAAGG - Intergenic
1122891832 14:104735608-104735630 CTGTGGCCACGTGGCAGGCCTGG + Intronic
1123106832 14:105845717-105845739 CTGAGGACAAGGGGCAGGGCAGG + Intergenic
1123427878 15:20187645-20187667 ATCTGGACAAGGGGCAGACCTGG - Intergenic
1124838084 15:33215126-33215148 CTTTGGACAAGTGGAAGATAAGG - Intergenic
1128665243 15:69532745-69532767 CTCTGGAGTCCTGGCAGGTCTGG - Intergenic
1129029261 15:72606623-72606645 GACTGGACAAGTGGAAGGTGAGG + Intergenic
1129037200 15:72657667-72657689 CATTGGACAAGTGGAAGGTGAGG + Intronic
1129187899 15:73921653-73921675 CACTGGAAACTTGGCAGGTCTGG + Intergenic
1129212687 15:74079559-74079581 CATTGGACAAGTGGAAGGTGAGG - Intronic
1129397712 15:75261527-75261549 CATTGGACAAGTGGAAGGTGAGG + Intronic
1129401323 15:75285804-75285826 CATTGGACAAGTGGAAGGTGAGG + Intronic
1129723805 15:77891612-77891634 CTGTGGAGCAGTGGCAGGGCTGG - Intergenic
1129729832 15:77923881-77923903 CATTGGACAAGTGGAAGGTGAGG - Intergenic
1129838688 15:78730102-78730124 CATTGGACAAGTGGAAGGTGAGG + Intergenic
1130312238 15:82765773-82765795 ATGTGGACACGTGGCAAGTCAGG - Intronic
1130894635 15:88160516-88160538 CTCTGGAAAAGGGGCAGGGCAGG - Intronic
1131594603 15:93784324-93784346 GGCTGGACAAGTGGCAGGGAGGG + Intergenic
1132087869 15:98922771-98922793 CTCTGGACATGTGAGAGCTCAGG - Intronic
1132320406 15:100920659-100920681 CCCTGGACAAGGGGCAGGGTGGG - Intronic
1132612475 16:824279-824301 CTGTGGACAGGCGTCAGGTCGGG - Intergenic
1132616904 16:845744-845766 CTCTGGAGAAGTGTCAGTTCTGG - Intergenic
1132623569 16:879533-879555 CTGTGGACACGGGGCAGGGCGGG + Intronic
1132745478 16:1434522-1434544 CTCTGGACAGGTGGCTGCGCTGG - Exonic
1133234781 16:4382703-4382725 CTCAGGACAAAGGGCAGGTGGGG + Exonic
1134020514 16:10918270-10918292 CTGTGGCCAAGTGGGAGGGCAGG - Intronic
1134296992 16:12955182-12955204 CTCTAGACAATGGGCATGTCAGG + Intronic
1134779441 16:16882504-16882526 CATTTGACAAGTGGCAGGTGGGG - Intergenic
1135502332 16:23007412-23007434 CACTTGACATGTGGCTGGTCTGG + Intergenic
1135547043 16:23373508-23373530 GCCAGGACTAGTGGCAGGTCTGG - Intronic
1136856417 16:33662116-33662138 ATCTGGACAAGGGGCAGACCTGG + Intergenic
1137870724 16:51947627-51947649 CACTGGAGAAGAGGGAGGTCAGG + Intergenic
1138407162 16:56805396-56805418 CTATGGAGAAGTGGTTGGTCTGG + Intronic
1138431033 16:56969389-56969411 CGATGGACAAGTGGCTGATCTGG - Exonic
1138571186 16:57874263-57874285 CTCTGGAGAAGGGGCATGCCAGG + Intergenic
1140770050 16:78195162-78195184 ATCTGAACAAGTGGAAGGGCTGG - Intronic
1141158643 16:81614107-81614129 TTCTGGAGAAGTGGCATTTCAGG + Intronic
1203117997 16_KI270728v1_random:1510593-1510615 ATCTGGACAAGGGGCAGACCTGG + Intergenic
1143728231 17:8864938-8864960 CACTGAACAAGTCGCAGGCCAGG + Intronic
1144809113 17:17987333-17987355 CCCTGGACATGTGGCAGGTCAGG - Intronic
1145787656 17:27604492-27604514 GGCTGCACAAGGGGCAGGTCTGG + Intronic
1146161351 17:30560812-30560834 TTCTGGCCAAGGGGGAGGTCTGG + Intronic
1146912408 17:36657198-36657220 CTCTGGACAGGTGACAAGTGGGG + Intergenic
1146941327 17:36846186-36846208 CTGTGGACATGTGACAGGTGAGG - Intergenic
1152063336 17:78095536-78095558 CTGTGTACAAGTGCCAGGGCAGG - Intronic
1152234528 17:79131812-79131834 CTCTGGCCAGGTGGCCGGGCAGG - Intronic
1152869402 17:82743924-82743946 CTCTGTTCAGGTGGCAGGACTGG + Intronic
1153523544 18:5974555-5974577 CTGTCCACAACTGGCAGGTCTGG - Intronic
1153792776 18:8595110-8595132 CTATGGCCTAGTGGCAGGTAGGG + Intergenic
1156885016 18:42125231-42125253 CTCTGTACAAGATGCAGTTCTGG - Intergenic
1157733920 18:50029787-50029809 CCCTGGACACATGGCAGGTTGGG + Intronic
1157955351 18:52090889-52090911 AGCTGGACAAGTTGCAAGTCTGG - Intergenic
1158190170 18:54818653-54818675 CACTGTAAAAGTGGGAGGTCAGG - Intronic
1159951275 18:74486190-74486212 CACTGGACACATGGCAGGACAGG - Intergenic
1161733171 19:5974750-5974772 CTCTGTACAGGTGGCAGCACAGG - Intronic
1163029795 19:14536934-14536956 CTCTGGACACGGGGCAGATGTGG + Intronic
1164147870 19:22523547-22523569 CACTGGACAAGTGGAAGGTGAGG - Intronic
1164894912 19:31866515-31866537 CACTGGACAACAGGCAGCTCAGG + Intergenic
1166198172 19:41219909-41219931 GTAGGGACAAGTGGCGGGTCAGG - Intronic
1167214755 19:48157084-48157106 CTCAGGAGATGTGGCAGGACGGG + Exonic
1167472608 19:49684053-49684075 CCCGGGACAAGTGGCTGGTGAGG + Exonic
925626761 2:5849137-5849159 CTCTGAACAAGTGGGAGGCACGG - Intergenic
926335873 2:11862373-11862395 CTGTGGAAAGGTGCCAGGTCAGG + Intergenic
926547170 2:14255948-14255970 CTGTGGTCAACTGGCAGGTCAGG - Intergenic
927562367 2:24083074-24083096 ATCTGGACATGTGGCAGAGCTGG - Exonic
930479201 2:51925994-51926016 CTCTGCACAGTTGGCAGGACTGG - Intergenic
932264619 2:70356876-70356898 CCCTGGAGAAGTGTCAGGTGTGG - Intergenic
941356793 2:164503916-164503938 CTCTGGACAAGAGGTAGGGCGGG + Intronic
944282615 2:197915108-197915130 CTCTGGACAGTTTGCAGCTCAGG + Intronic
946431591 2:219629434-219629456 CTTTGGAGGGGTGGCAGGTCAGG + Intronic
947324003 2:228955115-228955137 CTTTGGAGGAGAGGCAGGTCAGG + Intronic
947392818 2:229656423-229656445 CTCTGGAAAAGTGCAAGGTGAGG + Intronic
948166366 2:235865657-235865679 CTCTGGAGGAGGGGCAGGGCGGG + Intronic
948589612 2:239040633-239040655 ATCTGGAAGAGTGGCAGGTCAGG + Intergenic
1169904041 20:10582250-10582272 CTATGGAGAAGTGTCAGATCAGG - Intronic
1171291958 20:23987458-23987480 CTCTGCAGAAGGGGCAGGTTTGG + Intronic
1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG + Intergenic
1172809465 20:37637007-37637029 CTTCGGAGAAGTGGCAGGGCAGG - Intergenic
1173027414 20:39321143-39321165 CTCTGCAGAAGAGGCAGGTTTGG - Intergenic
1174298225 20:49563770-49563792 CTGTGGCCCAGTGGCTGGTCTGG - Intronic
1174343976 20:49915878-49915900 ATCATGATAAGTGGCAGGTCCGG - Intergenic
1175393152 20:58639961-58639983 CTCTGGACAAGACGCACTTCAGG - Intergenic
1176192106 20:63816447-63816469 CCCTGGGCCTGTGGCAGGTCAGG - Intronic
1178283777 21:31307728-31307750 CTCTGGACAAGTGAGGGGTAAGG + Intronic
1179634441 21:42698388-42698410 CTCTGGCCAAGAGGCAGGGAAGG - Intronic
1180743088 22:18067320-18067342 CTCTGGACAGATGGATGGTCTGG + Intergenic
1182692405 22:32173230-32173252 CTCTGGACACGCGGCAAGTCAGG - Intergenic
1184794972 22:46726875-46726897 GTCTGGATAAGTCGCAGCTCAGG - Intronic
950614162 3:14146158-14146180 CTCTGGACAGGTGGCAGTGGTGG + Exonic
953616186 3:44492827-44492849 AACTGGACATGTTGCAGGTCAGG + Intergenic
954690980 3:52395450-52395472 CCCTGGGCCAGGGGCAGGTCAGG + Exonic
956175061 3:66465156-66465178 CTGTGGACAAGGGGCTGTTCTGG + Intronic
958722443 3:97860978-97861000 CTCTGGGTAAGTGGCAGGTAGGG - Intronic
960138414 3:114128832-114128854 CTGGGGACACGTGGCATGTCTGG + Exonic
960997614 3:123350274-123350296 CACTGGACAAGACGCAGCTCCGG - Intronic
961056440 3:123792960-123792982 CTTTGTGTAAGTGGCAGGTCTGG - Intronic
961829988 3:129618459-129618481 CTCTGGACAGGTGGGAGGAAGGG - Intergenic
962076834 3:132090968-132090990 CTCAGGACAAGTAGGAGGCCTGG + Intronic
963149557 3:142031075-142031097 CTCTGGACAATTGGAGGGCCGGG - Intronic
963740456 3:149075065-149075087 CTCTTGACAAGTGGGAAATCTGG - Intronic
964221520 3:154352287-154352309 GGCTGGTCAAGTGGCTGGTCAGG - Intronic
967037431 3:185658297-185658319 CCCAGGAGAAGTGGCAGGTGCGG + Intronic
968653148 4:1767803-1767825 CTCTGCACAAAGGGCAGCTCCGG - Intergenic
968736335 4:2298648-2298670 CGGTGGACAAGTGGCAGGGAAGG + Intronic
968943793 4:3653234-3653256 CCCTGGACAGGTGGCAGGGCCGG - Intergenic
969971808 4:11055515-11055537 CTCGGGAACAGAGGCAGGTCAGG + Intergenic
973155098 4:46941806-46941828 CTCTTTACAATTGGCAGATCTGG - Intronic
983133429 4:164050615-164050637 TGCTGGACATGTGGCATGTCAGG + Intronic
993839908 5:92865567-92865589 CCTTGGACAAGTAGAAGGTCAGG - Intergenic
995751388 5:115456666-115456688 CTGTGGACAGGTGTCAGGGCAGG + Intergenic
998192940 5:140042560-140042582 TGCTGGACAAGTGGCCGCTCCGG - Exonic
1001727256 5:173915429-173915451 CTCTGGTCAGCTGGCAAGTCTGG + Intronic
1002189632 5:177472002-177472024 CTCTGGGCAAGTGGCCGGCTTGG - Intronic
1003109068 6:3238472-3238494 CGCTGGAGAAGGGGCAGCTCTGG - Intronic
1007477946 6:42131603-42131625 CTCTGGCCAAGGAGCAGCTCTGG + Intronic
1007679083 6:43621970-43621992 CTCTGGAGAAATGGAAGGCCAGG + Intronic
1007742377 6:44020745-44020767 CTAGGAACAAGTGGGAGGTCAGG + Intergenic
1007762781 6:44143050-44143072 TTCTGGCCAACTGACAGGTCTGG - Intronic
1015889068 6:137951358-137951380 CTCTGGGCAGGTGGTAGGGCAGG - Intergenic
1015913954 6:138196145-138196167 TCCTGGACAAGAGGCAGGGCAGG - Intronic
1019750174 7:2724290-2724312 TTCTCGACAGGTCGCAGGTCTGG - Intronic
1022010503 7:26304476-26304498 CTATGGACACATGGCAGGACTGG - Intronic
1024118538 7:46214866-46214888 CTCAGGCCAAGGGGCAGCTCAGG - Intergenic
1026452634 7:70542869-70542891 TTCTGGAGAAGGGGGAGGTCAGG - Intronic
1029435426 7:100561663-100561685 CTCTGAAGAAGAGGCAGGGCAGG + Intronic
1030126331 7:106155946-106155968 CACTGGAAGAGTGGCAGGTGGGG - Intergenic
1034303055 7:150033009-150033031 CTCTGGTCAGATGGCAGGACGGG + Intergenic
1034802993 7:154064259-154064281 CTCTGGTCAGATGGCAGGACGGG - Intronic
1035472186 7:159117580-159117602 CTTTGGACAATGGGCAGCTCTGG + Intronic
1037122872 8:15310353-15310375 CTCTGGACAAGTGACAAGTGGGG - Intergenic
1038153521 8:24964531-24964553 CTTTGGCCAAGTGTCAGGTGGGG - Intergenic
1039056389 8:33540468-33540490 CTCTGGACAAGTGGCAGGTCCGG + Intergenic
1045301450 8:100914210-100914232 CTCTGGGGAAGTGTCAAGTCAGG - Intergenic
1045717893 8:105069899-105069921 CTCAGGACTTGTGGCTGGTCAGG + Intronic
1047811064 8:128409583-128409605 CTCTGAACAAGGGGCACGTTCGG - Intergenic
1047982670 8:130199114-130199136 CTCTGGACCAGTGGCAGAATAGG + Intronic
1049584424 8:143426296-143426318 CTCTGTACAGCTGGCAGGGCTGG - Intronic
1051264626 9:15298816-15298838 CTCTGGACAGGTGGAGTGTCAGG - Intronic
1051845609 9:21448332-21448354 CTTTGGACAATGGGCAGCTCTGG + Intergenic
1053292622 9:36891505-36891527 CCCTCCACTAGTGGCAGGTCTGG - Intronic
1053430863 9:38040933-38040955 CTGGGGACACGTGGCAGGGCTGG + Intronic
1058057550 9:100464325-100464347 CTCTGGACAAAAAGCAGGTTTGG - Intronic
1060102163 9:120850121-120850143 CTATGGAACAGTGGCAGGTGGGG - Intergenic
1061065078 9:128272779-128272801 CATTGGACAAGTGGAAGGTGAGG - Intronic
1062028442 9:134351195-134351217 GTCTGAAGAGGTGGCAGGTCTGG + Intronic
1062366396 9:136211500-136211522 CTCTGGACAAGCGTGGGGTCAGG - Intronic
1190950146 X:55135602-55135624 CTCTGACCAAGTTGCAGTTCAGG + Intronic
1192946606 X:75969995-75970017 CTTTTTAAAAGTGGCAGGTCTGG - Intergenic
1193713871 X:84912955-84912977 CTCTGAAAAAGTTGCATGTCTGG + Intergenic
1194638151 X:96370780-96370802 CTTTGGACAAGTGGAAGATTAGG - Intergenic
1197723226 X:129759088-129759110 CTTTCCACAAGTGGCAGGGCTGG - Intronic
1199404868 X:147444920-147444942 CTCTGGCCACATGGCAGCTCTGG + Intergenic
1199725094 X:150572251-150572273 CTCTGGAAACTTGGCAGGGCAGG - Intronic
1199927355 X:152481052-152481074 CTCTGGGCAAGTCGCAGGAGGGG - Intergenic
1200085449 X:153602141-153602163 CTAAGGACAAGTGGCAGGCCTGG - Intergenic