ID: 1039057904

View in Genome Browser
Species Human (GRCh38)
Location 8:33551171-33551193
Sequence CTGGACTGCCTGGGGCAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 750
Summary {0: 1, 1: 0, 2: 1, 3: 119, 4: 629}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039057891_1039057904 21 Left 1039057891 8:33551127-33551149 CCACTGGGGCCAGCCAGGTAGTA 0: 1
1: 0
2: 1
3: 34
4: 326
Right 1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG 0: 1
1: 0
2: 1
3: 119
4: 629
1039057892_1039057904 12 Left 1039057892 8:33551136-33551158 CCAGCCAGGTAGTATCAACCAAT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG 0: 1
1: 0
2: 1
3: 119
4: 629
1039057890_1039057904 25 Left 1039057890 8:33551123-33551145 CCAACCACTGGGGCCAGCCAGGT 0: 1
1: 0
2: 1
3: 25
4: 251
Right 1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG 0: 1
1: 0
2: 1
3: 119
4: 629
1039057893_1039057904 8 Left 1039057893 8:33551140-33551162 CCAGGTAGTATCAACCAATGAAG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG 0: 1
1: 0
2: 1
3: 119
4: 629
1039057897_1039057904 -6 Left 1039057897 8:33551154-33551176 CCAATGAAGGGAGTCCCCTGGAC 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG 0: 1
1: 0
2: 1
3: 119
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039057904 Original CRISPR CTGGACTGCCTGGGGCAAGC CGG Intronic
900566673 1:3335745-3335767 CTGGCCTGGCAGGGGCAAGGAGG + Intronic
901093834 1:6662480-6662502 CTGGACTTCCTGGGTCAGGTGGG + Intronic
901316436 1:8312940-8312962 CTGGGCTGCCCTGGGCATGCCGG - Intergenic
902429607 1:16352698-16352720 CTGCACTGTCTGGGGCAACTGGG + Intronic
902656818 1:17874759-17874781 CTCGCCTGCCTGGGGCAGGAGGG + Intergenic
904362124 1:29983014-29983036 CTGGACTTCCTGGGTTAAGTGGG - Intergenic
904676490 1:32201970-32201992 CTGGGCTGGCTGGGCCAGGCAGG - Exonic
906766045 1:48435218-48435240 CTGGACTCCCTGGGTCAAGTGGG + Intronic
906767180 1:48444111-48444133 CTGGATTTCCTGGGTCAAGTGGG + Intronic
906891506 1:49720975-49720997 CTGGACTTCCTGGGTAAAGTGGG + Intronic
906988904 1:50716455-50716477 CTGGACTTCCTGGGTCGAGTGGG + Intronic
907270501 1:53288221-53288243 CTGGGCAGCCTTGGGCAAGGGGG + Intronic
907489557 1:54800429-54800451 CAGGCCTGGCTGGGGCAGGCGGG + Intronic
908848316 1:68347657-68347679 CTGGACTTCCTGGGCCAAGTGGG + Intergenic
909047487 1:70727963-70727985 CTGGACTGCCTGGAGCTGGCAGG + Intergenic
909358977 1:74740879-74740901 CTGGACTTTCTGGGTCAAGTGGG - Intronic
909359655 1:74745606-74745628 CTGGACTTCCTGGGTCGAGTGGG - Intronic
909446974 1:75758523-75758545 CTGGACTTCCTGGGTCGAGTGGG + Intronic
909747214 1:79112728-79112750 CTGGACTTTCTGGGTCAAGTGGG + Intergenic
910272218 1:85409045-85409067 CTGGGCTGCATGTGGCATGCAGG - Intronic
910380469 1:86621621-86621643 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
910459214 1:87430893-87430915 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
911247856 1:95538637-95538659 CTGGACTTTCTGGGTCAAGTGGG - Intergenic
911298589 1:96147687-96147709 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
911379621 1:97096500-97096522 CTGGACTTCCTGGGTCCAGTGGG + Intronic
911991781 1:104707154-104707176 CTGGACTTCCTGGGTCAATAGGG - Intergenic
912500599 1:110119595-110119617 CTGGACTGCCTGGGCTGGGCTGG - Intergenic
912675918 1:111680556-111680578 CTGGACTTCCTGGGTCGAGTGGG - Intronic
912946324 1:114087701-114087723 CTGGGCTGACTAGTGCAAGCAGG + Intergenic
913097065 1:115528638-115528660 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
913297696 1:117337596-117337618 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
913383327 1:118232889-118232911 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
913419319 1:118647695-118647717 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
915111897 1:153569169-153569191 CTGAACGGCCTGGGGAAAGGGGG - Intergenic
915401082 1:155622343-155622365 CTGGACTTCCTGGGTCAATAGGG - Intergenic
917025712 1:170639198-170639220 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
917085786 1:171304899-171304921 CTGGACTTCCTGGGCCAAATGGG + Intergenic
917280640 1:173375439-173375461 CTGGATTTCCTGGGTCAAGTGGG + Intergenic
917676723 1:177325469-177325491 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
917840774 1:178975554-178975576 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
918842554 1:189560930-189560952 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
918939959 1:190980636-190980658 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
919205959 1:194422157-194422179 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
919257371 1:195141564-195141586 CTGGACTTCCTGGGTTAAGTAGG + Intergenic
919506460 1:198404684-198404706 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
919558439 1:199091130-199091152 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
919958312 1:202439880-202439902 CTAGACAGTGTGGGGCAAGCAGG - Intronic
921354801 1:214276008-214276030 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
921421289 1:214951688-214951710 CTGGAGTGCATGGTGCAATCTGG - Intergenic
921938670 1:220817677-220817699 CTGGACTTCCTGGGTCTAGTGGG - Exonic
924270204 1:242324788-242324810 CTGGTCTGGGTGGGGCCAGCTGG - Intronic
924505777 1:244682366-244682388 CTGGACTTCCTGGGTCAGGTGGG - Intronic
1063224129 10:3998724-3998746 CTGGGCTGCATGGGGCCTGCAGG + Intergenic
1063414620 10:5863358-5863380 CTGGACTTCCTGGGTCAAATGGG + Intronic
1064588650 10:16865519-16865541 TTGGACTTCCTGGGTCAAGTGGG + Intronic
1064601851 10:17001550-17001572 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1064665616 10:17648171-17648193 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1064757714 10:18586977-18586999 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1066149605 10:32601552-32601574 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1066479350 10:35780422-35780444 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1067096838 10:43307189-43307211 CTGGACTTTCTGGGTCCAGCAGG - Intergenic
1067135686 10:43605623-43605645 CCGGACTGCCTGGAGCAAAACGG - Intergenic
1067539321 10:47140296-47140318 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1067559428 10:47294621-47294643 CTGGACTTCCTGGGTCAAGGGGG - Intergenic
1067743185 10:48912565-48912587 TTGGCTTGCCTGGTGCAAGCTGG - Intronic
1067854659 10:49781828-49781850 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1068142491 10:53025850-53025872 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
1068455528 10:57249945-57249967 CTTCACTGCCTGGGGCTGGCAGG - Intergenic
1068458087 10:57286158-57286180 CTGGGCTGCATGTGGCCAGCAGG + Intergenic
1068484890 10:57645117-57645139 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1068499943 10:57832381-57832403 CTGGACTTCCTAGGTCAAGTGGG + Intergenic
1068754355 10:60634398-60634420 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1069358424 10:67614271-67614293 CTGGACTTCCTGGGTCAAGTAGG - Intronic
1069612777 10:69786316-69786338 CTTGGCTGTCTGGGGCAGGCAGG + Intergenic
1069894145 10:71670190-71670212 CTGGATTGCATGGGGCGAGGCGG - Intronic
1070637233 10:78139376-78139398 CAGGACTGCCGGGAGGAAGCAGG - Intergenic
1070660245 10:78300553-78300575 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1070780786 10:79136317-79136339 CTTGACTTCCTGGGACAGGCTGG - Intronic
1070973014 10:80582801-80582823 CAGGACTGCCTGCAGCAAGCAGG - Intronic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1072721950 10:97786680-97786702 TTGGACTGCCTGGGACACGGGGG + Intergenic
1074085965 10:110209123-110209145 GTCGACTGCCTGGGGAAAGCTGG - Intronic
1074265226 10:111895195-111895217 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1075612066 10:123862286-123862308 GTGGAATGCCTGGGGCATGGCGG - Intronic
1075869866 10:125763427-125763449 CTGCACTGCCGGCGGCAAGCTGG - Exonic
1076067395 10:127459683-127459705 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG + Intergenic
1076896544 10:133315869-133315891 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1076908697 10:133376962-133376984 CTGGAAGGCCTGGTGCAAGGAGG - Intergenic
1076987434 11:249036-249058 GAAGACTGCCTGGGGCCAGCAGG + Exonic
1077186572 11:1238137-1238159 GTGGGCTGCCTGGAGGAAGCAGG + Intronic
1077302420 11:1853507-1853529 CTGGACTGCCAGGGAGGAGCTGG + Intronic
1077477643 11:2797909-2797931 CTGGGCTGCCTGGGCCAACCTGG - Intronic
1080331960 11:31149260-31149282 CTGGACTTCCTGGGTCAAGAGGG + Intronic
1080692546 11:34570517-34570539 CTGGAGTCCCTGGGTCCAGCTGG - Intergenic
1081145638 11:39560230-39560252 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1081181445 11:39990263-39990285 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
1081324472 11:41728337-41728359 CCTCACTGCCTGGGGCCAGCAGG + Intergenic
1084437125 11:69149720-69149742 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1084456947 11:69273415-69273437 CTGGGCTGTCTGGGGCAACCAGG - Intergenic
1084894853 11:72258593-72258615 CTTCACTGCCAGGGGCAAGCTGG + Intergenic
1085375876 11:76060671-76060693 CCTCACTGCCTGGGGCCAGCAGG - Intronic
1086054288 11:82628746-82628768 CTGGACTACCTGGATCAAGTTGG + Intergenic
1086279736 11:85171772-85171794 CTGGACTCCCTGGAGCTGGCAGG - Intronic
1086820747 11:91433436-91433458 CTGAACTCCCTGGAGCTAGCTGG + Intergenic
1087458645 11:98419959-98419981 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087965659 11:104410909-104410931 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1088817507 11:113431900-113431922 GTGGCCTGCCTGGGGCAGCCTGG - Intronic
1089614701 11:119688662-119688684 CAGGGCTGGCTGTGGCAAGCTGG + Intronic
1089685175 11:120142100-120142122 CTGGTCTGACAGGGCCAAGCAGG - Intronic
1090280097 11:125448408-125448430 CTGGTCTGGCATGGGCAAGCTGG + Intronic
1090513121 11:127396547-127396569 CTGGACTGCCTGGGTCGAGTGGG + Intergenic
1091127029 11:133109627-133109649 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1091256189 11:134188049-134188071 TTGGACTTCCTGGGTCAAGTGGG + Intronic
1092165037 12:6337187-6337209 CTGGGCTTACTGGGGCCAGCTGG - Intronic
1092960360 12:13591202-13591224 AGTGAGTGCCTGGGGCAAGCAGG + Intronic
1093023131 12:14221133-14221155 CTGGACTTCCTGGGTCAATAGGG + Intergenic
1093213288 12:16332983-16333005 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1093967418 12:25341853-25341875 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1094254952 12:28412879-28412901 CTGGACTTCCTGGGTCGAGTAGG - Intronic
1094319377 12:29169127-29169149 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1094320376 12:29175891-29175913 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1094345960 12:29469550-29469572 CTGGCCTGCTGGGAGCAAGCAGG + Intronic
1094400312 12:30056056-30056078 CTGGACTTCCTGGGTCGAGTAGG - Intergenic
1094474330 12:30829671-30829693 CTTGAGTGCCTGGTGCATGCAGG - Intergenic
1094776122 12:33730063-33730085 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1095163950 12:38949657-38949679 CTGGACTACCCTGGGAAAGCTGG - Intergenic
1095214684 12:39534193-39534215 CTGGACTGGCAGGGGCATGATGG - Intergenic
1095597249 12:43972855-43972877 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1097296215 12:57965765-57965787 CTGGACTTCCTGGGTCAATAGGG + Intergenic
1097414279 12:59295372-59295394 CTGGACTTCCTGGGTCAAATGGG + Intergenic
1097830360 12:64217995-64218017 CTGGACTGCATGTGGCCCGCAGG + Intronic
1099375926 12:81896412-81896434 CTGGACTCCCTGGGTCGAGTGGG + Intergenic
1099797959 12:87422215-87422237 CTGGACTTCCTGAGTCAAGTGGG - Intergenic
1100050503 12:90443755-90443777 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100209439 12:92386729-92386751 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1100210499 12:92393767-92393789 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1100528782 12:95445450-95445472 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100529271 12:95449137-95449159 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100530640 12:95458289-95458311 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100984186 12:100189246-100189268 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1101251959 12:102945704-102945726 CTGGACTGCCCTGGGCCAGAGGG - Intronic
1101704530 12:107209719-107209741 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1102530006 12:113539340-113539362 TTGGTCTCCCTGGGGGAAGCTGG + Intergenic
1102642522 12:114379510-114379532 CTGGGCTGGCTGGGACAACCTGG - Intronic
1103802296 12:123546485-123546507 CTGGATTGGATGGGGCAGGCTGG + Intergenic
1104010947 12:124929581-124929603 CTGAACTTCCTGGAGCAAACCGG + Intergenic
1104219885 12:126772631-126772653 CTGGACTTCCTGGGTCAATAGGG - Intergenic
1104306905 12:127617714-127617736 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1105431811 13:20343734-20343756 CTGGACTTCCTGGGTCGAGAGGG + Intergenic
1105476309 13:20730632-20730654 CTGGACTTCCTGGGTCTAGTGGG + Intronic
1105489812 13:20877108-20877130 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1105720359 13:23107675-23107697 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1105725404 13:23158780-23158802 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1106062876 13:26312034-26312056 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1106178464 13:27351204-27351226 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
1106351724 13:28937120-28937142 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1106471053 13:30054515-30054537 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1106845805 13:33736639-33736661 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1107170193 13:37332221-37332243 CTGGACTTCCTGGGTCAAGTAGG + Intergenic
1107624745 13:42271604-42271626 CTTAACAGCCTGGGGCCAGCTGG - Intergenic
1107790914 13:44001421-44001443 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1108149760 13:47521325-47521347 TTGGACTTCCTGGGTCAAGTGGG - Intergenic
1108849235 13:54707190-54707212 CTGGACTTCCTGGTTCAAGTGGG + Intergenic
1109007746 13:56900827-56900849 CCTCACTGCCTGGGGCCAGCAGG - Intergenic
1109419782 13:62096360-62096382 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1109423981 13:62148974-62148996 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1109425172 13:62157784-62157806 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1109735524 13:66479544-66479566 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1110079382 13:71291412-71291434 CTGGACTTCCTGGGTCAATAGGG - Intergenic
1110906430 13:80896475-80896497 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1111316436 13:86567183-86567205 ACTGACTGCCTGGGGAAAGCAGG + Intergenic
1111337975 13:86846955-86846977 CTGGACTTCCTGGGTCAGGTGGG + Intergenic
1111532063 13:89550586-89550608 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1111729284 13:92052712-92052734 CTGGACTTCCTGGCTCAAGTGGG - Intronic
1111929460 13:94498701-94498723 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1113338477 13:109399588-109399610 CTGGACTTCCTGGGTCGAGTAGG - Intergenic
1113479957 13:110613537-110613559 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1114049559 14:18912312-18912334 CTGCACTGCTTTGGGCAAGTGGG - Intergenic
1114113003 14:19489619-19489641 CTGCACTGCTTTGGGCAAGTGGG + Intergenic
1114575337 14:23707677-23707699 CTGGACTTCCTGGGTCAAGCGGG - Intergenic
1114670158 14:24406698-24406720 TGGGACTGCCAGGGGAAAGCAGG + Intronic
1116156138 14:41208712-41208734 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1116329795 14:43581120-43581142 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1116331690 14:43604787-43604809 CTGGAGAGACTGGGGCAAGGAGG - Intergenic
1116698219 14:48202792-48202814 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1116859103 14:49979380-49979402 CTGAAAGGCCTGGGGCTAGCAGG - Intergenic
1117419506 14:55530574-55530596 TTTGGCTGCCTGGGGCCAGCGGG + Intergenic
1118379033 14:65202791-65202813 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1118532180 14:66718773-66718795 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1118547169 14:66904578-66904600 CTGGACTTCCTGGGTCAACCAGG - Intronic
1118764433 14:68900403-68900425 CTGGACTCCCTGGAGAAGGCAGG + Intronic
1118784447 14:69034438-69034460 CTGGTCTGCCTGGGGTCAACTGG + Intergenic
1119559785 14:75580862-75580884 CTGGATTGCCTGAAGCATGCAGG + Intronic
1120387623 14:83866067-83866089 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
1120556482 14:85934282-85934304 CTGGACTTCCTGGGTCAATAGGG + Intergenic
1121072197 14:91034389-91034411 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1121154303 14:91668192-91668214 CTGGACTTCCTGGGTCGAGTAGG + Intronic
1121716462 14:96079570-96079592 CTGGTCTTCCTGGTGCAAGTGGG + Intronic
1122279235 14:100611299-100611321 CTGGCCCGCCTGGGGTAGGCAGG + Intergenic
1122614522 14:103007920-103007942 CTGGCCTGCCTTAGGCAGGCAGG + Intronic
1122755261 14:103973603-103973625 CTGGAATGCAGGGAGCAAGCAGG - Intronic
1122861413 14:104584274-104584296 CTGCACGGCCTGGGGCTGGCTGG - Intronic
1123667803 15:22622203-22622225 ATGGATTACCTGGGGCTAGCTGG - Intergenic
1123814455 15:23962458-23962480 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1123823346 15:24055069-24055091 CTGGACTGCCTGGAACTAGCTGG + Intergenic
1123896148 15:24832389-24832411 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1124049808 15:26186574-26186596 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1124090891 15:26599046-26599068 CTTGACTTCCTGGGTCAAGCTGG - Intronic
1124441029 15:29686425-29686447 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1124522737 15:30418590-30418612 ATGGATTACCTGGGGCTAGCTGG - Intergenic
1124535927 15:30547625-30547647 ATGGATTACCTGGGGCTAGCTGG + Intergenic
1124762725 15:32459969-32459991 ATGGATTACCTGGGGCTAGCTGG - Intergenic
1124775901 15:32589098-32589120 ATGGATTACCTGGGGCTAGCTGG + Intergenic
1126072388 15:44876352-44876374 CTGGACTTCCTGGGCCAAATGGG - Intergenic
1126188193 15:45851211-45851233 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1126734841 15:51720641-51720663 CTGGACTTCCTGGGTCGAGTGGG + Exonic
1127093231 15:55487108-55487130 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1127366290 15:58293776-58293798 ATGCAATGCCTGGGGGAAGCTGG - Intronic
1128259650 15:66223974-66223996 CTGTCCTTCCTGGGCCAAGCAGG - Intronic
1128793120 15:70447751-70447773 CTGGACAGGCTGGAGCAAGTGGG + Intergenic
1130272928 15:82461693-82461715 CTTGCCTGCCTGGGGCACTCAGG + Intergenic
1130465277 15:84189046-84189068 CTTGCCTGCCTGGGGCACTCAGG + Intergenic
1130487411 15:84405756-84405778 CTTGCCTGCCTGGGGCACTCAGG - Intergenic
1130498989 15:84484490-84484512 CTTGCCTGCCTGGGGCACTCAGG - Intergenic
1130587569 15:85193659-85193681 CTTGCCTGCCTGGGGCACTCAGG + Intergenic
1131007967 15:88993967-88993989 CTGGACTTCCTGAGTCAAGTGGG + Intergenic
1131013409 15:89038262-89038284 CAGGACAGCCTGGGTGAAGCAGG - Intergenic
1131136172 15:89937715-89937737 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1131410844 15:92207170-92207192 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1131411911 15:92214386-92214408 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1131738329 15:95358753-95358775 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1132545045 16:529032-529054 CTGGCCTGTCTGGGGGAGGCAGG + Intronic
1132849922 16:2020333-2020355 CTGGACCGCCGCGGGCAAGGGGG + Intronic
1133110378 16:3544538-3544560 CTGAACCGCCAGAGGCAAGCAGG + Intronic
1133327044 16:4948171-4948193 CTTGGCTGCCTGGGCCCAGCAGG - Intronic
1133554240 16:6889655-6889677 CTGGACTACATGGTGGAAGCTGG - Intronic
1133971010 16:10568009-10568031 CTGGGCTTCCTGAGGCAAGACGG - Intronic
1134125353 16:11612531-11612553 CTGCACTGCATGCGGCCAGCGGG + Intronic
1135399395 16:22155780-22155802 CTGGGCTGGCTGGGAGAAGCAGG - Intronic
1135542505 16:23342735-23342757 CTGGGCTGCCTGTGGCCTGCAGG + Intronic
1136382004 16:29900191-29900213 CCGGGCTGCCTAGGGCCAGCGGG + Intergenic
1137049097 16:35693106-35693128 TTAGACTGTCTGGGGTAAGCAGG + Intergenic
1137052371 16:35725027-35725049 TTAGAATGCCTGGGGCCAGCTGG + Intergenic
1137053374 16:35731565-35731587 TTAGACTGCCTGGGGTCAGCTGG + Intergenic
1137675725 16:50302931-50302953 GTGGCCTGGCTGGGGCAAGGTGG + Intronic
1138168063 16:54821131-54821153 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1138493903 16:57395428-57395450 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1138585888 16:57970281-57970303 CGGGGCTGCCTGGGGCTGGCTGG - Intronic
1139545643 16:67648384-67648406 CGGGACTTCCTGGGGGAAGTGGG - Exonic
1139676003 16:68524072-68524094 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1139953176 16:70681617-70681639 CTAGCCTGCCTGGGACAACCAGG + Intronic
1140249085 16:73278909-73278931 CTGGACTTCCTGGGTCGAGAGGG - Intergenic
1141547454 16:84780611-84780633 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1141636449 16:85316577-85316599 CTGGACTGCCCGTGGCCAGTAGG + Intergenic
1141651157 16:85393896-85393918 CAGGACTGCCGGGCGCAAGCTGG - Intergenic
1141768434 16:86073926-86073948 CTGGACAGTCCTGGGCAAGCAGG - Intergenic
1141917393 16:87108833-87108855 CTGGATTGCGTGGGGCTAGTTGG - Intronic
1141952380 16:87347289-87347311 CTGGGCTCCCTGCGGCACGCTGG - Intronic
1142352600 16:89586951-89586973 CTGGGCTGCCTGCGGGAGGCAGG + Intronic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1144017428 17:11209360-11209382 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1144166302 17:12614252-12614274 CTGGACTGTCCTGGACAAGCAGG - Intergenic
1144481325 17:15631799-15631821 CTGGGCTTCCTGGGGAAAGAAGG + Intronic
1144732355 17:17536077-17536099 CTGCACTGACTGTGGCATGCAGG + Intronic
1144916980 17:18731932-18731954 CTGGGCTTCCTGGGGAAAGAAGG - Intronic
1145036062 17:19541384-19541406 CTGGACCGCCTGGGTCTAGTGGG + Intronic
1145791992 17:27633019-27633041 TTGGAGGGCCTGGGGGAAGCTGG + Intronic
1145803785 17:27711928-27711950 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1146295086 17:31643154-31643176 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1146311434 17:31771351-31771373 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1146846468 17:36184212-36184234 CTGGAGGGCCTGGGGGAGGCTGG + Intronic
1147253655 17:39168510-39168532 CTGGACTTCCTGGGTCGAGCGGG + Intergenic
1147314303 17:39612304-39612326 CTGGGCTGAGTGGGGCCAGCAGG + Intergenic
1147375391 17:40019822-40019844 GTGGACTGCCTGGAGCAGGGTGG - Exonic
1148366188 17:47057536-47057558 CCTGACTGCCTGGGGCCGGCAGG + Intergenic
1148492275 17:48030960-48030982 CTGGACTGCCTGGGGCACTAAGG - Intronic
1148502598 17:48103015-48103037 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1148763907 17:50026503-50026525 GGGGACTGCCTGGAGCCAGCAGG + Intergenic
1149597220 17:57871410-57871432 CTGGGCTCCCAGGGGCAGGCTGG + Intronic
1149682721 17:58517366-58517388 CTGCACTGCCTGAGGAAAGCAGG - Intronic
1149849815 17:60027605-60027627 CTGGAGGGCCTGGGGGAGGCTGG + Intergenic
1149860353 17:60118919-60118941 CTGGAGGGCCTGGGGGAGGCTGG - Intergenic
1149964908 17:61152466-61152488 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1150161176 17:62899399-62899421 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1150178303 17:63086701-63086723 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1150652270 17:67017874-67017896 CAGAGCTGCCCGGGGCAAGCAGG - Intronic
1150924381 17:69517276-69517298 CTGTGTTGCCTGGGACAAGCAGG + Intronic
1151512635 17:74570666-74570688 CTGGAAGGCCTGGAGCAGGCAGG - Intergenic
1151619472 17:75237132-75237154 CTAGAGTGGCTGGGACAAGCTGG + Exonic
1151901724 17:77020376-77020398 CTGGGCTGCCTGGGGCAGATGGG - Intergenic
1152685729 17:81693095-81693117 TTGGACTGCCTGGGGCGCCCCGG + Intronic
1153041509 18:816658-816680 CATGACTGCCATGGGCAAGCAGG - Intergenic
1153300450 18:3587376-3587398 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1153460279 18:5325364-5325386 CTGGACTCTCTGGAGCCAGCAGG - Intergenic
1153522759 18:5967810-5967832 CAGGACTCCCTGGGGCAGGAGGG + Intronic
1153906709 18:9668190-9668212 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1153967102 18:10191965-10191987 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1153968901 18:10206719-10206741 CTGGAGTGCAAGGGGCGAGCGGG + Intergenic
1154080158 18:11248305-11248327 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1155129778 18:22921509-22921531 CTGAAATACCTGGAGCAAGCAGG + Intronic
1155573998 18:27225349-27225371 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1155611717 18:27674116-27674138 CTTCACTGCCCGGGGCCAGCAGG + Intergenic
1156628647 18:38940891-38940913 CTGGACTTCCTGGGTCAACAGGG + Intergenic
1157239963 18:45999596-45999618 CTGGACTTCCTGGGCCAAGGGGG - Intronic
1157433759 18:47651689-47651711 CTGGACTGGCTGGGACACGTTGG - Intergenic
1158482262 18:57832258-57832280 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1159161588 18:64648766-64648788 CTGGACTTCCTGGGTCCAGTAGG - Intergenic
1159656217 18:71031960-71031982 CCTCACTGCCTGGGGCCAGCGGG + Intergenic
1160823633 19:1069367-1069389 CTGGGCTGCCAGGGACAAACAGG - Intronic
1160921426 19:1522789-1522811 CTGGCCAGCCTGGGGCCACCGGG - Intergenic
1161550259 19:4908942-4908964 CTGGACAGCCTGGAGAAGGCGGG + Intronic
1161598558 19:5165746-5165768 CTGGACTTCCTGGGTCGAGCGGG - Intronic
1161897330 19:7092331-7092353 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1162250108 19:9435423-9435445 CTCGGCGGCCTGGGGCAAACCGG + Intronic
1162365392 19:10245648-10245670 CTGGATGGCCTTGGGCAAGTGGG - Intergenic
1163235752 19:16029528-16029550 CCGGACACCCTGGGGCAGGCGGG + Intergenic
1163596944 19:18225920-18225942 CTCGCCGGCCTGGGGCAGGCAGG - Intronic
1163638662 19:18449663-18449685 CTGGGCTGCCCTGGGCCAGCTGG + Intronic
1163891585 19:20021184-20021206 CTGGACTGCATGCAGCCAGCAGG + Intronic
1164029508 19:21389658-21389680 CTGGACTTCCTGGGTCAAATGGG + Intergenic
1164371323 19:27646817-27646839 CTAGACTGCCTGGGGTCAGGTGG + Intergenic
1164374993 19:27676593-27676615 TTTGACTGCCTGGGGTAGGCTGG + Intergenic
1164375247 19:27678357-27678379 TTAGACTGCCTGGGGTCAGCTGG + Intergenic
1164375261 19:27678425-27678447 TTAGACTGCCGGGGGCAAGCTGG + Intergenic
1164376190 19:27690420-27690442 CTAGACTGCCTGGGGTCTGCCGG + Intergenic
1164379308 19:27718561-27718583 TTAGACTGCCTGGGGTCAGCTGG + Intergenic
1164379476 19:27719740-27719762 TTAGACTGCCTGGGGTCAGCTGG + Intergenic
1164382112 19:27744291-27744313 TTAGACTGCCTGGGGTCAGCTGG + Intergenic
1164385106 19:27765418-27765440 TTAGAATGCCTGGGGTAAGCAGG + Intergenic
1164844247 19:31418381-31418403 CTGGACAGACTGGGACAAGCTGG + Intergenic
1164992404 19:32693817-32693839 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1164993336 19:32700484-32700506 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1165265674 19:34661740-34661762 CTGGGCTGCATGGGGCCTGCAGG - Intronic
1165884551 19:39068643-39068665 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1166010815 19:39941265-39941287 CTGGGCTGCGTGGTGCCAGCAGG + Intergenic
1166888205 19:45973837-45973859 CTTGGCTCCCTGGGGCAAGAGGG + Intergenic
1166993357 19:46706338-46706360 CTGGAAAGCCTGGAGCAGGCGGG - Intronic
1168330387 19:55564462-55564484 CCGGCCTCCCTGGGGCAAGCGGG - Intergenic
925370352 2:3340341-3340363 CTGCTCTGCCTCGGGCAAGCCGG - Intronic
925421844 2:3719005-3719027 CTGGACTTCCTGGGTCGAGTGGG - Intronic
925515118 2:4673414-4673436 CTGGACTTCCTGGGTCAATAAGG - Intergenic
925906251 2:8541197-8541219 CTGCCATGCCTGGGGCAGGCAGG - Intergenic
925952679 2:8929787-8929809 CTGGGCTTCCTGGGTCAAGTAGG + Intronic
926088696 2:10036245-10036267 CTGGCCTGTCTGGGGGAGGCTGG + Intergenic
926228859 2:10987690-10987712 CAGGGCTGCCTGGGGTGAGCAGG - Intergenic
926281115 2:11447245-11447267 TTTGACTGCCTGGGTCAAGCAGG + Intronic
927201822 2:20582910-20582932 CTGGCCTGGCTGGAGCAGGCAGG - Intronic
928013218 2:27629873-27629895 GTGGAGTGCCTTGGGCATGCAGG - Exonic
928413809 2:31074538-31074560 CAGGTCTGCCTGGGGCTAACTGG + Intronic
929197948 2:39205839-39205861 CAGGACTGCCCTGGGCGAGCTGG + Intronic
929233700 2:39585462-39585484 CCCCACTGCCTGGGGCCAGCAGG - Intergenic
929267385 2:39933333-39933355 CTGGACTGCCTAGGGGATGGTGG + Intergenic
929647423 2:43641410-43641432 CTGGGCTGCCTGTGGCCTGCAGG - Intronic
929804398 2:45132134-45132156 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
929924051 2:46194908-46194930 CACGGCTGCCTGGGGAAAGCTGG + Intergenic
931768399 2:65477080-65477102 ATGGACTTCCTGGGTCAAGTGGG - Intergenic
931803681 2:65783460-65783482 CAGGACAGGCTTGGGCAAGCTGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934020570 2:87947386-87947408 CTGGACTTCCTGGGTCAAGTAGG + Intergenic
934554273 2:95279063-95279085 CTGCAGTGCCTGGGCCCAGCGGG - Exonic
935761022 2:106320825-106320847 CTGGACTTCTTGGGTCAAGTGGG - Intergenic
935788444 2:106570001-106570023 CAGGACAGCCTGGGTCAAACTGG + Intergenic
935789443 2:106577551-106577573 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
936050332 2:109217825-109217847 CTCCCCTGCCTGGGGGAAGCTGG - Intronic
936090133 2:109496440-109496462 CTGGACTTCCTGGGTCGAGTGGG - Intronic
936090396 2:109498373-109498395 CTTGCCAGCCTGGTGCAAGCTGG + Intronic
936802074 2:116282431-116282453 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
936803011 2:116289155-116289177 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
937050459 2:118884135-118884157 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
937454203 2:122027272-122027294 CTGGGCCGCATGGGGCAAGCAGG + Intergenic
937706590 2:124927763-124927785 CTGGACTTCGTGGGTCAAGTGGG + Intergenic
937906082 2:127053528-127053550 CTGGATGGCCTGGGGCGAGCGGG - Intronic
938056116 2:128215939-128215961 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
938129345 2:128697907-128697929 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
939085304 2:137711126-137711148 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
939106353 2:137952981-137953003 CTGGACTTCCTGGGTCAATAGGG - Intergenic
939551974 2:143626807-143626829 CTGGAATTCCTGGGTCGAGCGGG - Intronic
939851490 2:147311325-147311347 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
939852574 2:147318726-147318748 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
939912050 2:147994936-147994958 CTGGACTTCCTGGGTCGAGTGGG + Intronic
940855144 2:158723674-158723696 CTGGAGTGCCTGGGGCCACTGGG - Intergenic
941244081 2:163075064-163075086 CTGAACTCCCTGGTGCAAGGTGG + Intergenic
941601167 2:167545564-167545586 CTGGACTTCCTGGGACAATAGGG - Intergenic
942111410 2:172686266-172686288 CTGGATTTCCTGGGTCAAGGCGG + Intergenic
942302110 2:174572164-174572186 CTGGGCTGCCTGGGGCCTCCGGG + Exonic
942375701 2:175334494-175334516 CAGGATAGTCTGGGGCAAGCAGG - Intergenic
942582102 2:177430128-177430150 CTGGACTGCCTGGAGCTGGCAGG + Intronic
943468826 2:188266317-188266339 CAGGACTACCTGGGAGAAGCTGG - Intergenic
943577697 2:189650692-189650714 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
943608573 2:190005462-190005484 CTGGACTTCCTGGGTCCAGTGGG - Intronic
944857270 2:203780011-203780033 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
945582344 2:211611117-211611139 CTGGACTTCCTGGGTCAATAGGG + Intronic
947641946 2:231711837-231711859 CTGTCCAGCCTGGGGCCAGCTGG + Intronic
947922584 2:233891058-233891080 CTGGACTGCATGTGGCCCGCAGG - Intergenic
948218966 2:236254217-236254239 CTGTACTGCCTACAGCAAGCTGG - Intronic
948661086 2:239506952-239506974 CTGGGCTGTCTGGGCCTAGCAGG - Intergenic
948931420 2:241134844-241134866 CTGGAGTTCCTGGGGCAGGCTGG - Intronic
1169647991 20:7834818-7834840 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1169853587 20:10079210-10079232 CTGGACTTCCCGGGTCAAGTGGG - Intergenic
1169921920 20:10744206-10744228 TTGGAATGCATGGGGCCAGCTGG + Intergenic
1170230879 20:14045037-14045059 CTTCACTGCCTGGGGCTTGCGGG + Intronic
1170989219 20:21286865-21286887 GTGGACTGCATGGAGGAAGCAGG - Intergenic
1171505513 20:25629876-25629898 CTGGACAGTCTGGGGACAGCTGG + Intergenic
1171849960 20:30301099-30301121 CTGGACTGCCTGGATGATGCAGG + Intergenic
1172176924 20:32978031-32978053 CGGCACTGCCAGGGGGAAGCTGG - Intergenic
1172340264 20:34152076-34152098 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1173242720 20:41312075-41312097 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1173292638 20:41728060-41728082 CTGGACTTCCTGGGCCCAGCAGG - Intergenic
1173448477 20:43141394-43141416 CTGGGGTGACTGGGGCAACCGGG + Intronic
1174130536 20:48340828-48340850 CTGGGCTGCGGGAGGCAAGCTGG - Intergenic
1174422553 20:50409090-50409112 GTGCAGTGCCTGGGACAAGCTGG + Intergenic
1174795949 20:53522697-53522719 CTGGGTTGCCTGGGGCACACAGG - Intergenic
1175762227 20:61569026-61569048 CTGGACTGCATGGGTCATGGGGG + Intronic
1175899343 20:62353867-62353889 CTGGGCTGCAGGGAGCAAGCGGG + Intronic
1176091528 20:63320553-63320575 CTGGAGGCCCTGGGGCAGGCTGG + Intronic
1176127701 20:63483317-63483339 CAGGACTGCCAGGGGCACCCAGG + Intergenic
1177134735 21:17296948-17296970 CTGGACTTCCTGGGTCCAGCGGG + Intergenic
1177136078 21:17306486-17306508 CTGAACTTCCTGGGTCAAGTGGG + Intergenic
1177967950 21:27751818-27751840 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1179439123 21:41380824-41380846 CTCCAGTGCCTGGGGCAGGCAGG - Intronic
1180024457 21:45151803-45151825 ATGGCCAGCCTGGGGCGAGCAGG - Intronic
1180342137 22:11627989-11628011 CAGGGATGCCTGGGGAAAGCAGG - Intergenic
1180468038 22:15634687-15634709 CTGCACTGCTTTGGGCAAGTGGG - Intergenic
1181474025 22:23157784-23157806 CTGGGCTGCCGGGTGCAGGCTGG + Intronic
1181894482 22:26094902-26094924 CTGGACTTCCTGGGTCGAGGGGG - Intergenic
1182075261 22:27491107-27491129 CTGGACAGCCTGGCCCATGCTGG + Intergenic
1182419236 22:30240853-30240875 CTGGACTGGCTGGGTCAGGGTGG + Exonic
1182642948 22:31783013-31783035 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1182861814 22:33566895-33566917 CTGGACTTCCTGGGTCAAATGGG - Intronic
1184885864 22:47344107-47344129 CTGGAGGGCATGGGGAAAGCAGG + Intergenic
1185015063 22:48338384-48338406 CTGGCCCGCCTGGGTCAGGCCGG - Intergenic
1185106019 22:48870359-48870381 CAAGGCTGCCTGGGGGAAGCAGG - Intergenic
949671878 3:6406977-6406999 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
950256664 3:11511849-11511871 CCCCACTGCCTGGGGCCAGCAGG + Intronic
950286958 3:11752571-11752593 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
950306441 3:11918182-11918204 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
950440079 3:13005407-13005429 CTGGTCTGCTGGGGGCAGGCAGG - Intronic
950457837 3:13103150-13103172 CTGACCTGCCTGGGGCCAGCCGG - Intergenic
950852613 3:16077156-16077178 CTGGACTTCCTGGGTCGAGCAGG + Intergenic
951021122 3:17781668-17781690 CTGGACTTCCTGGGTCGAGTGGG + Intronic
951994079 3:28707519-28707541 CTGGACTGCATGTGGCTGGCGGG - Intergenic
952453685 3:33453556-33453578 CCTCACTGCCTGGGGCCAGCAGG - Intergenic
952500670 3:33958896-33958918 CTGCATGGCTTGGGGCAAGCTGG + Intergenic
953622348 3:44544015-44544037 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
953623307 3:44550927-44550949 CTGGAATTCCTGGGTCAAGTGGG - Intergenic
953674077 3:44986339-44986361 CCTCACTGCCTGGGGCCAGCTGG + Intronic
954231504 3:49221472-49221494 CTGGACTTCCTGGGTCGAGTGGG - Intronic
954232631 3:49229218-49229240 CTGGACTTCCTGGGTCTAGTGGG - Intronic
954709158 3:52496427-52496449 CTGGACTGCCTGTGGGATCCTGG - Intronic
954810532 3:53244525-53244547 CTTGCCTGCCTGTGGCCAGCAGG - Intronic
957146738 3:76434604-76434626 CTGGACTGCCTGGAGCAAAACGG + Intronic
958884793 3:99713853-99713875 GTGGCCAGCCTGGGGCAAGTTGG - Intronic
959285319 3:104400905-104400927 CTGGACTTCCTGGGCCGAGTGGG - Intergenic
959564273 3:107818410-107818432 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
959581896 3:107991157-107991179 CTGAAGTGCCTGTGACAAGCAGG - Intergenic
960064096 3:113352086-113352108 CTGGACTTCCTGGGTCAAGTGGG + Intronic
960352083 3:116606293-116606315 CTGGACTCTCTGGGTCAAGTGGG + Intronic
960538733 3:118842194-118842216 CTGGACTTCCTGGGTCAATAGGG + Intergenic
960540033 3:118851709-118851731 CTGGACTTCCTGGGTCAATAGGG + Intergenic
961319839 3:126064834-126064856 CTGGAATGCGTGGAGCAGGCAGG - Intronic
961518750 3:127455160-127455182 CTGGGTTGCCTGGGGAAAGGGGG - Intergenic
961580123 3:127874191-127874213 CTGGACTGCTTCTGGCAGGCTGG - Intergenic
961746858 3:129069308-129069330 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
962318576 3:134373704-134373726 CTGGTACGCCTGGGGCGAGCCGG + Intronic
963103799 3:141628344-141628366 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
963263321 3:143214534-143214556 CAGGACAGTCTGGGGCAAACTGG - Intergenic
963409574 3:144910035-144910057 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
963697339 3:148577610-148577632 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
964083728 3:152790604-152790626 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
964198147 3:154088119-154088141 CCTCACTGCCTGGGGCCAGCGGG - Intergenic
964223635 3:154372159-154372181 CTGGGCTTCCTGGGTCAAGTAGG + Intronic
964604921 3:158550263-158550285 CTGGACTTCTTGGGTCGAGCGGG - Intergenic
964866199 3:161264592-161264614 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
966039279 3:175461431-175461453 CTGGAATTCCTGGGTCAAGTGGG - Intronic
966881847 3:184355009-184355031 GTGGGCTGCCTGGGGCCAGGTGG - Intronic
967214495 3:187198993-187199015 CAGGCCTGACTGGGGCCAGCTGG - Intronic
967734605 3:192939150-192939172 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
968083056 3:195860194-195860216 CTTCAGTGCCTGGGACAAGCCGG + Intergenic
968506009 4:971839-971861 CTGGACTGCCTGGGGCTCCGTGG - Intronic
968511248 4:996896-996918 CTGTCCTGCGTGGGCCAAGCGGG - Intronic
968750566 4:2386947-2386969 CCTGACTGCCGGGGGCCAGCGGG - Intronic
969390706 4:6889701-6889723 CTGGCCTGCCTGGCACACGCTGG + Intergenic
969493982 4:7515428-7515450 CTGGGTGGCCTTGGGCAAGCTGG + Intronic
969654986 4:8491663-8491685 CCTCACTGCCTGGGGCCAGCAGG + Intronic
970008009 4:11428800-11428822 CTGGATGGCCCGGGGCAGGCGGG + Exonic
970687662 4:18586947-18586969 CTGGAGTGGCTAGGGCAAGAGGG + Intergenic
971578130 4:28302973-28302995 CTGAACTTCCTGGGTCAAGTGGG + Intergenic
971579037 4:28309859-28309881 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
971607518 4:28676931-28676953 CTGAACTGCCTTGGGGAAGAAGG + Intergenic
972133646 4:35864971-35864993 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
972231111 4:37073728-37073750 CTGGACTTCCTGGGTCAATAGGG - Intergenic
972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG + Intergenic
972651452 4:41021365-41021387 CTGGACTTCCTGGGTCGAGTGGG + Intronic
972880758 4:43418901-43418923 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
972889301 4:43536554-43536576 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
973048563 4:45567160-45567182 CCTCACTGCCTGGGGCCAGCGGG - Intergenic
974340070 4:60603672-60603694 CTGGACTCCCTGGAGCCGGCAGG + Intergenic
974509785 4:62823676-62823698 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
975342429 4:73257939-73257961 GTGGTCTGCCTGGGGCCAGTAGG - Intronic
976727472 4:88228657-88228679 CTGGACTTCCTGGGTCAAGTGGG + Intronic
977220889 4:94336503-94336525 CTGGACTGGCTGATGCAAACTGG - Intronic
977657272 4:99536557-99536579 CTGCACTCCCTGGAGCCAGCAGG + Intronic
979576083 4:122293874-122293896 CCGGACTCCCTGGAGCAGGCAGG - Intronic
980001731 4:127497492-127497514 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
980291261 4:130849313-130849335 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
980512477 4:133812375-133812397 CTGCACTGGCTGGGGGAAGTGGG - Intergenic
980969224 4:139554098-139554120 CTTGAATGTCTGGGGCAATCTGG - Intronic
982773020 4:159415313-159415335 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
983033750 4:162836673-162836695 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
984081397 4:175253386-175253408 CTCCACTGCCTGGGACAAGGGGG + Intergenic
984206021 4:176789032-176789054 CAGGACTGCCAAAGGCAAGCAGG + Intronic
984290560 4:177788917-177788939 CTGGGCTTCCTGGGTCAAGTAGG + Intronic
985559689 5:577638-577660 CTGGACTTCCTGGGTCGAGTAGG - Intergenic
985664170 5:1173366-1173388 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
985971055 5:3378905-3378927 CTGTAATCCCTTGGGCAAGCTGG - Intergenic
986060877 5:4188875-4188897 CTGCTCTGCCTGGGGAATGCTGG + Intergenic
986871130 5:12048160-12048182 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
986929154 5:12796190-12796212 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
987225635 5:15838145-15838167 CTGAGCTGCCTGGGACAACCTGG - Intronic
987361630 5:17112355-17112377 CTGGACTTCCTGGGTCGAGTGGG + Intronic
987418880 5:17694437-17694459 ATGGGCTGCCTGGAGGAAGCTGG - Intergenic
987467165 5:18285699-18285721 CTGGACTTCCTGGGCCGAGTGGG + Intergenic
987503986 5:18746501-18746523 CTGGACTTCCTGGGTCAATAGGG - Intergenic
987673509 5:21045075-21045097 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
987818751 5:22934885-22934907 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
987929528 5:24387059-24387081 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
988016771 5:25569539-25569561 CTGGACTTCCTGGGTCAATATGG - Intergenic
988039960 5:25876333-25876355 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
988357474 5:30197755-30197777 CTGGACATCCTGGGTCAAGTGGG + Intergenic
988866291 5:35338824-35338846 AGGGACTGCCTAGGGCCAGCAGG - Intergenic
989281829 5:39653289-39653311 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
989780075 5:45254201-45254223 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
990176324 5:53112354-53112376 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
990216738 5:53541182-53541204 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
991039990 5:62165228-62165250 CTGGGCTGCCTGTAGCAAGATGG - Intergenic
991275797 5:64844789-64844811 TTTGACTGCCTGGGTCAAACAGG - Intronic
991997754 5:72404829-72404851 CTGGACTTCCTGGGTTAAGTGGG + Intergenic
992409934 5:76495452-76495474 CTGGGCTGCCAGGGACCAGCTGG + Intronic
992545393 5:77809942-77809964 CTGGACTTCCTGGGTCAAGTGGG + Intronic
993199535 5:84796524-84796546 CTGGTCTGCATGGGGCCCGCAGG - Intergenic
994489701 5:100425366-100425388 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
994756268 5:103797398-103797420 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
995258302 5:110072718-110072740 CTGGACTCCCTGGAGCTAGCAGG + Intergenic
996665767 5:126058461-126058483 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
997150408 5:131487695-131487717 CTGGACTTCCTGGGTCAAGTAGG - Intronic
997356845 5:133267859-133267881 CTGGCTTGGCTGGGGCAAGAAGG + Intronic
997522317 5:134530847-134530869 CTGGCCTGCCTGTGGCTTGCAGG - Intronic
997788470 5:136735504-136735526 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
999100221 5:149017673-149017695 CTGGACTCTCTGTGGCAGGCAGG + Intronic
999605934 5:153315885-153315907 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
999784916 5:154882284-154882306 CTGGTCTGCGTGGGGGAAGATGG - Intergenic
999794526 5:154976557-154976579 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1000084731 5:157879389-157879411 CCTCACTGCCTGGGGCCAGCTGG - Intergenic
1000442483 5:161280326-161280348 CTGGAGTGGCTGGGGCAACTGGG + Intergenic
1000518357 5:162268780-162268802 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1000535441 5:162472493-162472515 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1000826110 5:166046046-166046068 CTGGATTGCCTGGGGAATGACGG - Intergenic
1001445792 5:171781776-171781798 CTGGACTCCCTGGGTCGAGTGGG + Intergenic
1001497275 5:172198120-172198142 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1001527836 5:172441355-172441377 CTGCTCGGCCTGGGGCCAGCAGG + Intronic
1001594552 5:172889529-172889551 CTGGAGTGCCTGGTGTCAGCAGG + Intronic
1001948699 5:175800985-175801007 CTGGACTGCATGGGGACAGATGG + Intronic
1002308419 5:178297914-178297936 CTGTACGGCCTGCAGCAAGCTGG + Intronic
1002577455 5:180182787-180182809 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1002617565 5:180465034-180465056 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1002854020 6:1021899-1021921 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1003271931 6:4614971-4614993 CTGGACTTCCTGGGTCAAGTCGG - Intergenic
1003329839 6:5120885-5120907 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1003824902 6:9942283-9942305 CTGTACTGCCCGGGGCTGGCGGG - Intronic
1004248450 6:14002535-14002557 CCTCACTGCCTGGGGCCAGCGGG - Intergenic
1004532245 6:16464122-16464144 CTGGACTTCCTGGGTCAAGTAGG + Intronic
1004545379 6:16593178-16593200 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1005304167 6:24497588-24497610 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1006759744 6:36449628-36449650 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1008257173 6:49317387-49317409 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1009060036 6:58387617-58387639 CTGAACTCCCTGGAGCCAGCAGG - Intergenic
1009230879 6:61059775-61059797 CTGAACTCCCTGGAGCCAGCAGG + Intergenic
1009688015 6:66988291-66988313 CTAGACTTCCTGGGTCAAGTGGG - Intergenic
1009907658 6:69889448-69889470 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1009946596 6:70347764-70347786 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1012506348 6:99951053-99951075 CTGGGCTGCCTGGTGGGAGCTGG - Intronic
1013888263 6:114997833-114997855 CTGGACTCCCTGGGTCAATACGG + Intergenic
1014404996 6:121040234-121040256 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1014499279 6:122165334-122165356 CCTCACTGCCTGGGGCCAGCAGG + Intergenic
1017028691 6:150202365-150202387 CAGGACAGCCTGAGGCAAGGAGG - Intronic
1017353235 6:153469514-153469536 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1017917253 6:158840963-158840985 CTGGTCTGGCTGGGGCCATCTGG + Intergenic
1017920446 6:158867997-158868019 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1019463054 7:1171415-1171437 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1019478115 7:1253875-1253897 CCAGACTGCATGGGGCAGGCAGG - Intergenic
1019492640 7:1322410-1322432 CTGGCCTGACTGGGGGCAGCTGG - Intergenic
1021060622 7:16106058-16106080 CTTGACTTTCTGGGTCAAGCTGG - Intronic
1021433656 7:20589551-20589573 CTAGACTTCCTGGGTCAAGTGGG - Intergenic
1021757106 7:23862146-23862168 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1022077221 7:26983803-26983825 CTGGACTTCCTAGGGCATCCTGG - Intronic
1022457392 7:30570068-30570090 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1023801036 7:43835014-43835036 CTGGACTTCCTGGGTCAATAGGG - Intergenic
1024285274 7:47751681-47751703 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1024945493 7:54803750-54803772 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1025248272 7:57334362-57334384 GTGCAGTGCCTGGGACAAGCTGG - Intergenic
1026541531 7:71283807-71283829 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1026867956 7:73834909-73834931 CTGGACAGGCTGGAGCAGGCTGG - Exonic
1027702298 7:81484160-81484182 CTTGACTTCCTGCGTCAAGCAGG - Intergenic
1027791937 7:82645347-82645369 TTGGACTTCCTGGGTCAAGTGGG + Intergenic
1028012943 7:85672288-85672310 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1029311356 7:99668396-99668418 CTGGACTGCATGAGGCCTGCAGG - Intronic
1030010847 7:105165394-105165416 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032074778 7:128831200-128831222 CTGGACTCCCCGGGGCACCCAGG - Intronic
1032081976 7:128863786-128863808 CTGGACTGTTTGGGGGAAACAGG - Intronic
1032683089 7:134205333-134205355 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1032713950 7:134488079-134488101 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1032720079 7:134543970-134543992 CTGGATTACCTGGGCCAGGCAGG - Intergenic
1032722855 7:134564854-134564876 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1032927826 7:136629188-136629210 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1033219426 7:139518513-139518535 CTGTACTCCCAGGAGCAAGCAGG - Intergenic
1033251173 7:139761174-139761196 CTGTACTGCCTGGGGCCGTCTGG - Intronic
1033273510 7:139953927-139953949 CTGGGCTGCTTGTGGCCAGCGGG - Intronic
1033857707 7:145585083-145585105 CTAGACTTCCTGGGTCAAGTGGG + Intergenic
1033979784 7:147149404-147149426 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG + Intergenic
1034635766 7:152566076-152566098 CTGGCTTGCCTGGAGCCAGCTGG + Intergenic
1035335400 7:158124769-158124791 CTGGTCAGCCTGGGCCACGCTGG + Intronic
1035366181 7:158350368-158350390 CTGCACTTCCTGGGTGAAGCAGG - Intronic
1035542524 8:452984-453006 CAGCACTGAGTGGGGCAAGCTGG - Intronic
1036155016 8:6333390-6333412 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1036480744 8:9137373-9137395 CTGGTCTTTCTGGGGCAACCTGG + Exonic
1036501360 8:9317384-9317406 CTTGACTTCCTGGGACAAGTAGG + Intergenic
1036653789 8:10662619-10662641 ATGAGCTGCCTGGGGCCAGCTGG - Intronic
1036766565 8:11553340-11553362 CTGGACTGCCCTGGGCAGGCAGG - Intronic
1036920993 8:12855227-12855249 CTGGACATCCTGGGTCAAGTGGG - Intergenic
1037303331 8:17477604-17477626 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1037774490 8:21823981-21824003 CTGGACTTCCTCCTGCAAGCAGG + Intergenic
1037818591 8:22124874-22124896 CTGGCCTGTCTGGGGCAAGAGGG + Intronic
1037895395 8:22649213-22649235 TTGGACTGCCCAGGGCAACCAGG + Intronic
1038524889 8:28264139-28264161 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1038718428 8:30012184-30012206 CTGGACTGTCAGGGGCAGGCAGG + Intergenic
1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG + Intronic
1039129613 8:34248159-34248181 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1039276555 8:35938859-35938881 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1040700306 8:50055501-50055523 CTGGAATGCGTGGGGCAGGGAGG + Intronic
1041135189 8:54750513-54750535 CTGGACTTCCTAGGTCAAGTGGG + Intergenic
1042469030 8:69161985-69162007 CAGAACAGCCTGGGGCAAGCAGG - Intergenic
1042771533 8:72387868-72387890 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1042919228 8:73906041-73906063 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1042920349 8:73913604-73913626 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1042979143 8:74506174-74506196 CTGGACTTCCTGGGTCAATAGGG - Intergenic
1044004618 8:86926172-86926194 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1044067998 8:87722244-87722266 CTGGACTTCCTGGGTCAAATGGG - Intergenic
1045198690 8:99956594-99956616 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1045858185 8:106788725-106788747 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1045858898 8:106793635-106793657 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1045861855 8:106822490-106822512 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1046522089 8:115338195-115338217 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1046986852 8:120397786-120397808 CTGGACTCCCTGGAGCTGGCAGG - Intronic
1047512743 8:125528138-125528160 CTGGACTGGCTGGCGTATGCAGG - Intergenic
1048053476 8:130841692-130841714 CTGGACTCCCTGGAGCTATCTGG + Intronic
1048208702 8:132436875-132436897 CTGGGCTGCCTGGAGTAAGTGGG - Intronic
1048210473 8:132450463-132450485 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1048989880 8:139755018-139755040 CTTGGCTGCCTGGGGCCAACAGG + Intronic
1049000485 8:139822804-139822826 CTGAACTGACTGTGGCAGGCAGG - Intronic
1049212132 8:141391793-141391815 CAGGTCGGCCTGGGGCAGGCGGG - Intergenic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1049449992 8:142655420-142655442 CAGGACTGCCCAGGGAAAGCAGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049645838 8:143735236-143735258 CCGGACAGGCTGGGGCAGGCAGG + Intergenic
1049832683 8:144712488-144712510 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1051680332 9:19600975-19600997 CTGGACTTCCTGGGTCTAGTGGG + Intronic
1051955458 9:22687623-22687645 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1052318207 9:27138538-27138560 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1052989885 9:34512906-34512928 CCTAACTGCCTGGGACAAGCAGG + Intronic
1053056737 9:34997427-34997449 CTGGGCTGCCTGGGGGGAGTGGG + Exonic
1053848284 9:42264256-42264278 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1054575875 9:66856422-66856444 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1055241813 9:74195451-74195473 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1055457841 9:76489704-76489726 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1055648979 9:78388555-78388577 CTGGAGTGGCAGGGGCCAGCTGG + Intergenic
1055748285 9:79474915-79474937 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1055990281 9:82098649-82098671 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1056846441 9:90041723-90041745 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1056884510 9:90428264-90428286 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1057280017 9:93702403-93702425 GAGGAATGCCTGGGGCAGGCAGG + Intergenic
1057310441 9:93939647-93939669 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1057341332 9:94204521-94204543 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1057343476 9:94225356-94225378 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1057457896 9:95231031-95231053 CTGGACTTCCTAGGTCAAGTGGG - Intronic
1057496939 9:95568780-95568802 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1057821347 9:98333479-98333501 ATGGAATGCCTGGGGCCACCGGG - Intronic
1057823054 9:98348508-98348530 GTGGACTGCCTGGGGCAGTATGG + Intronic
1058379757 9:104364356-104364378 CTGGACTTCCTGGGTCATGTGGG - Intergenic
1059207039 9:112476812-112476834 TTTGACTTCCTGGGTCAAGCTGG - Intronic
1059340275 9:113594108-113594130 CTGGACTCCCAGGCACAAGCCGG - Intronic
1059408643 9:114118215-114118237 CTGGAATTCGTGGGGCAGGCTGG + Intergenic
1060196901 9:121629628-121629650 CTGGGCTGTCTGGGGCACTCTGG + Intronic
1060527486 9:124328608-124328630 CCCGAGTGCCTGCGGCAAGCGGG + Intronic
1060743876 9:126117162-126117184 TGGGACTGCCAGGGGCAGGCTGG + Intergenic
1062440958 9:136569033-136569055 CAGGAGGGCCTGGGGCAACCAGG - Intergenic
1186076094 X:5880959-5880981 CTGGACCCCGTGGTGCAAGCTGG + Intronic
1186928139 X:14357817-14357839 CTTGACTGCCTGTGGCAATGAGG + Intergenic
1187818197 X:23256157-23256179 CTGGACTCTCTGGAGCCAGCAGG - Intergenic
1189810702 X:44778290-44778312 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1189896850 X:45665031-45665053 CCTCACTGCCTGGGGCAGGCAGG + Intergenic
1190541026 X:51479213-51479235 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1190951105 X:55143678-55143700 CTGGGCTTCCTGGGTCAAGTAGG - Intronic
1191815621 X:65241385-65241407 CTGGACTCCCTGGAGCCGGCAGG + Intergenic
1192482167 X:71495047-71495069 CTGGACTCCCTGGGTCGAGTGGG - Intronic
1193458084 X:81755369-81755391 CTGGACTGTCTAGAGCCAGCAGG - Intergenic
1193462342 X:81806399-81806421 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
1193574932 X:83185353-83185375 CTGTACTCCCTGGTGCCAGCTGG - Intergenic
1193888517 X:87013440-87013462 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1193958982 X:87900417-87900439 CTGGACTTCCTGGGTCAATAGGG + Intergenic
1194155613 X:90384223-90384245 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1195552774 X:106187022-106187044 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1196312877 X:114189017-114189039 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
1196378416 X:115061773-115061795 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
1196419799 X:115509814-115509836 CTGGACTTCCTGGGTCAGGTGGG - Intergenic
1197398787 X:125962755-125962777 CTGGACGTCCTGGGTCAAGTGGG - Intergenic
1197575858 X:128210619-128210641 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
1198465838 X:136904094-136904116 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
1198977330 X:142351449-142351471 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1199123951 X:144091743-144091765 CTGGACTTCCTGGGTCAAATAGG - Intergenic
1200249085 X:154542627-154542649 CAGGACACCCTGGGGCAGGCTGG - Intronic
1200364022 X:155642047-155642069 CTGGGCTTCCTGGGTCTAGCAGG - Intronic
1200372179 X:155739105-155739127 CTGGACTCTCTGGAGCCAGCAGG - Intergenic
1200392588 X:155958786-155958808 CTGGGCTTCCTGGGTCTAGCAGG - Intergenic
1200474074 Y:3623351-3623373 CTTTATTGCCTGGGGCCAGCAGG + Intergenic
1200710922 Y:6484317-6484339 CTGGACTTCCTGGATCAAGTGGG + Intergenic
1200776888 Y:7177282-7177304 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1200801375 Y:7390113-7390135 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1200966382 Y:9043010-9043032 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1201023012 Y:9677668-9677690 CTGGACTTCCTGGATCAAGTGGG - Intergenic
1201312417 Y:12608702-12608724 CTGGACTTCCTAGGTCAAGTGGG - Intergenic
1201396276 Y:13552558-13552580 CTGGACTTCCTGGGTCAAGAGGG + Intergenic
1201406735 Y:13657598-13657620 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1201407841 Y:13666200-13666222 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1201424104 Y:13830633-13830655 CTGGACTTCCTGGGTCAATAGGG - Intergenic
1201456010 Y:14167406-14167428 CTGGACTTCCTGGGTCGAGCGGG + Intergenic
1201471572 Y:14340995-14341017 CTGGACTTCCTGGGTCAATAGGG - Intergenic
1201519220 Y:14853772-14853794 CTGGACCCCGTGGTGCAAGCTGG - Intergenic
1201531335 Y:14992191-14992213 CTAGACTTCCTGGGTCAAGTGGG + Intergenic
1201649272 Y:16266970-16266992 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
1201653537 Y:16318330-16318352 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
1201676817 Y:16595218-16595240 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1201750340 Y:17424453-17424475 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
1201931231 Y:19351677-19351699 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1201989232 Y:20006884-20006906 CTGGACTTCCTGGGTCGAGCGGG - Intergenic
1202082400 Y:21097570-21097592 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1202089563 Y:21175757-21175779 CTGGACTTCCTGGGTCAAGTGGG - Intergenic