ID: 1039057905

View in Genome Browser
Species Human (GRCh38)
Location 8:33551179-33551201
Sequence TCTGAAGTCCGGCTTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039057905_1039057918 25 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057918 8:33551227-33551249 GACCCAGAGGTGAGGCCAGGGGG 0: 1
1: 0
2: 7
3: 48
4: 449
1039057905_1039057914 17 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057914 8:33551219-33551241 CTCAGGGAGACCCAGAGGTGAGG 0: 1
1: 0
2: 6
3: 36
4: 475
1039057905_1039057915 22 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057915 8:33551224-33551246 GGAGACCCAGAGGTGAGGCCAGG 0: 1
1: 3
2: 2
3: 56
4: 473
1039057905_1039057917 24 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057917 8:33551226-33551248 AGACCCAGAGGTGAGGCCAGGGG 0: 1
1: 1
2: 4
3: 50
4: 425
1039057905_1039057916 23 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057916 8:33551225-33551247 GAGACCCAGAGGTGAGGCCAGGG 0: 1
1: 0
2: 2
3: 58
4: 412
1039057905_1039057911 1 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057911 8:33551203-33551225 ACTGAAGGGGTTTAGCCTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1039057905_1039057910 0 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057910 8:33551202-33551224 CACTGAAGGGGTTTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 117
1039057905_1039057912 12 Left 1039057905 8:33551179-33551201 CCTGGGGCAAGCCGGACTTCAGA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1039057912 8:33551214-33551236 TTAGCCTCAGGGAGACCCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039057905 Original CRISPR TCTGAAGTCCGGCTTGCCCC AGG (reversed) Intronic
901138488 1:7012751-7012773 TCTGAATTCTGTCTTGCTCCTGG + Intronic
911996184 1:104770116-104770138 TCTTAAGTCAGGCTTGTTCCAGG + Intergenic
913562028 1:120031188-120031210 TCTGACATCCAGCTTGCACCTGG - Intronic
913636096 1:120762406-120762428 TCTGACATCCAGCTTGCACCTGG + Intergenic
914282612 1:146190579-146190601 TCTGACATCCAGCTTGCACCTGG - Intronic
914543642 1:148641295-148641317 TCTGACATCCAGCTTGCACCTGG - Intronic
914622979 1:149429714-149429736 TCTGACATCCAGCTTGCACCTGG + Intergenic
915071330 1:153271883-153271905 TCTAAAGGCCGGCTTGCTGCTGG + Intergenic
915590888 1:156869658-156869680 TCTGATGTCCTGCCTGCCCCTGG + Intronic
917782372 1:178411886-178411908 TCTGAAGGCCGACTGGCCCCAGG - Intronic
920535320 1:206733360-206733382 TCTGCAGCCCTGCCTGCCCCTGG - Exonic
922808236 1:228401572-228401594 TTTGTAGTCCAGCTGGCCCCAGG - Intronic
923837203 1:237625332-237625354 TCTGAAGTCCGAGATGCCCAAGG + Intronic
1067467997 10:46515604-46515626 TCTGGAGTCAGGCCAGCCCCAGG + Intergenic
1067545425 10:47189377-47189399 TGTAAATTCCTGCTTGCCCCTGG - Intergenic
1069636810 10:69930116-69930138 TCTGAAGACAGTCTTGGCCCTGG + Intronic
1076606722 10:131694346-131694368 TCAGAAGTCTATCTTGCCCCAGG - Intergenic
1084858847 11:72005241-72005263 TCTGAAGACCTGCTATCCCCTGG - Exonic
1085293594 11:75417777-75417799 TCTGAGGTGCTGCTTGTCCCAGG + Intronic
1089395255 11:118132457-118132479 TCTAAACCCAGGCTTGCCCCAGG + Intergenic
1090635949 11:128690565-128690587 GCGGAAGTCCTGCTTCCCCCGGG - Intronic
1090822963 11:130361344-130361366 TCTGAAGTCTGGGTTTCCTCAGG + Intergenic
1103121074 12:118379865-118379887 TCTGAAGTACGGCTGTCCCTCGG + Intronic
1103462881 12:121119091-121119113 TCTGAAATCCCACATGCCCCTGG - Intergenic
1105904975 13:24799562-24799584 TCTGAAGTCCTGATTGTCACTGG + Exonic
1107338764 13:39383822-39383844 TCTGCAGAAAGGCTTGCCCCTGG - Intronic
1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG + Intronic
1122813357 14:104300017-104300039 TCTGAACCCCGGCTTTCTCCTGG + Intergenic
1129232463 15:74204315-74204337 TCTGAAGTCCCTCTTACCCAAGG - Intronic
1134657451 16:15957956-15957978 TCAGAAGTTCTGCTAGCCCCAGG + Intronic
1135509310 16:23068653-23068675 TCTGAAGTCCTGCTCTTCCCAGG + Exonic
1136589398 16:31208320-31208342 TCTGTGGTCCTTCTTGCCCCAGG - Intergenic
1141346144 16:83247965-83247987 TCTGAAGTCCAGGAAGCCCCAGG + Intronic
1141557227 16:84844214-84844236 TCTGAAGACAGGCTGGCCCCAGG - Intronic
1141926820 16:87175265-87175287 TCTGATGTCTGGTGTGCCCCTGG - Intronic
1142117612 16:88368162-88368184 TCTGATGCCAAGCTTGCCCCTGG - Intergenic
1142472805 17:172591-172613 GCTGAAGTCCAGCGTGCCCAGGG + Exonic
1146033556 17:29387394-29387416 TCTGAAGTCAGTCCTGACCCTGG - Intergenic
1147670655 17:42175013-42175035 TCTGAAGTCTGGCCAGCACCTGG - Intronic
1148757452 17:49981027-49981049 CCTGCAGTCTGGCTTCCCCCAGG - Intergenic
1149495814 17:57116666-57116688 TCTGAGGTCAGGCTTGCAGCAGG + Intronic
1149649226 17:58266334-58266356 TCTGAAGTCTGGCCTGCACTGGG + Intronic
1150652267 17:67017866-67017888 TCCGACCTCCTGCTTGCCCCGGG + Intronic
1150799667 17:68270572-68270594 TCTGTAGTCCAGATTGACCCTGG - Intronic
1151351654 17:73535454-73535476 TCTGCAGTCCGGCTGCCTCCTGG + Intronic
1152551325 17:81031875-81031897 TCTGAAGTCACTCTTGCCTCCGG + Intergenic
1153014408 18:570668-570690 TTTGAAGTTCAGCTTGCCCGTGG + Intergenic
1155055933 18:22183850-22183872 TTTAAAGTCCTGCTTGCCGCAGG - Intronic
1160470703 18:79130129-79130151 TCTGATGTCTGGCTTTCCTCAGG - Intronic
1160581235 18:79885655-79885677 ACTGAAGCCAGGCTGGCCCCAGG - Intronic
1162726346 19:12691708-12691730 TCTGAAGTCAGGCTGACCCATGG - Intronic
1163777013 19:19224738-19224760 TCTGAAGCCCGACTTGCCCATGG + Intronic
1165812282 19:38618738-38618760 TCTGAGGTCCCTCTTGCCACAGG - Intronic
926242754 2:11101043-11101065 TCCGAAGTCCTGTTTCCCCCAGG - Intergenic
927053738 2:19352117-19352139 TCTGAAGTGCCGCGTGCGCCAGG + Exonic
932123312 2:69120986-69121008 TCTGGGGTCCTTCTTGCCCCGGG + Intronic
932471427 2:71961992-71962014 CCTGAAGTCCTACTTTCCCCTGG + Intergenic
932813565 2:74844018-74844040 TCTGGATTCTGGCTTGCCCTGGG - Intronic
935244008 2:101202849-101202871 GCTGGAGTCCTGCCTGCCCCTGG - Intronic
936334215 2:111574930-111574952 TCTGAGGTTGGGCTTGACCCAGG - Intergenic
936926245 2:117739955-117739977 TCTGAGGTCCAGCTTGGCACAGG - Intergenic
942504487 2:176627095-176627117 TCTAAAGTTCGCCTTGCACCCGG + Intergenic
946060441 2:216936558-216936580 TCTCAAATCCTGCCTGCCCCTGG - Intergenic
946669811 2:222090537-222090559 TCTGAAGTCAGTCTTACCCTAGG - Intergenic
947365256 2:229388012-229388034 TCTGAAGCCAGCCTTTCCCCAGG - Intronic
1170454243 20:16517685-16517707 TCTGGAGTCCTGAGTGCCCCTGG - Intronic
1170471587 20:16673427-16673449 TCTGAGGTCTTGCTGGCCCCTGG + Intergenic
1174040260 20:47694372-47694394 TCTGAACTCAGCCTTTCCCCCGG - Intronic
1182437120 22:30337809-30337831 TCTGTGGTCCGGCTGCCCCCAGG - Exonic
1183042679 22:35193950-35193972 TCTGATGTCTGGCTTGATCCAGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
953841717 3:46394952-46394974 TTTGAACTTCGGATTGCCCCTGG + Intergenic
956301292 3:67775260-67775282 TCTGAAGTCCAGCTGTCTCCCGG + Intergenic
956974789 3:74566934-74566956 TCTGATGTCCTGCTTTCCACTGG + Intergenic
960974543 3:123161662-123161684 TCTGGAGTCCAGCCTGCCTCTGG - Intronic
961514837 3:127426035-127426057 CCTCAAGTCCAGCTTCCCCCAGG - Intergenic
963254764 3:143133864-143133886 TCTGAAGTCAGCCTTACCCTTGG + Intergenic
965541639 3:169877533-169877555 TCTGACCTCAGGCTTTCCCCAGG - Intergenic
968460208 4:721000-721022 TCTGAGCTCCTGCTTGCCCATGG - Intronic
971327168 4:25654214-25654236 TCTGCAGTCCGCCTTGCCCAGGG + Intergenic
975579568 4:75894575-75894597 ACTGAAGTCAGGCAGGCCCCAGG + Intronic
985968883 5:3359816-3359838 TCTGAACTCCTGCTTGCCACGGG - Intergenic
986439987 5:7772262-7772284 GCTGAAGGCAGGCCTGCCCCAGG - Intronic
990976713 5:61567277-61567299 TCTGAAGTCCTGCAGGCCACAGG + Intergenic
992258479 5:74946171-74946193 TCTGACTCCCGGCTTGACCCAGG - Intergenic
995312146 5:110726266-110726288 TCTGAATTCAAGGTTGCCCCAGG + Intronic
995802978 5:116019833-116019855 TCTCAGGTCCAGCTTGGCCCTGG + Intronic
997474085 5:134132777-134132799 TCTGAAGTCAAGCTTGGGCCTGG - Intronic
999436957 5:151570651-151570673 GCTGATGCCTGGCTTGCCCCTGG + Intergenic
1002772516 6:301815-301837 TCTGGAGCCCGGCTTGCTGCAGG - Intronic
1003428961 6:6021631-6021653 TTTGAAGTCCGGGTTCACCCAGG - Intergenic
1010581217 6:77598456-77598478 ACTGATGTCTGGCTTTCCCCAGG - Intergenic
1013373962 6:109496271-109496293 TGTGCAGTCCGGTTTGCACCAGG + Intronic
1015862861 6:137698806-137698828 TTTGAATTCCGGCTTGATCCTGG + Intergenic
1017484880 6:154893281-154893303 TCTAATGTCAGCCTTGCCCCTGG + Intronic
1023903024 7:44498830-44498852 TATAAAGTCAGGCTGGCCCCTGG - Intergenic
1029347576 7:99989702-99989724 TCTGAAATCCGAATTGCTCCAGG - Intergenic
1029563787 7:101321573-101321595 TCTGATCTGCGGCTTGCTCCCGG - Intronic
1031986914 7:128169171-128169193 TCTGAAGTCTGGCTAGCCTTTGG - Intergenic
1032677105 7:134141245-134141267 TCTGAAGTTTGGCCTGCACCAGG - Intronic
1034162941 7:149005996-149006018 GCTGAAGTACGCCCTGCCCCTGG - Exonic
1037658195 8:20905440-20905462 TCTGAGGTATGCCTTGCCCCAGG - Intergenic
1038922429 8:32099549-32099571 TCTTAAGTCCTTCTTGCCCTAGG - Intronic
1039057905 8:33551179-33551201 TCTGAAGTCCGGCTTGCCCCAGG - Intronic
1043150406 8:76707563-76707585 CCTGAAATCCGGCTTGCCAGTGG + Exonic
1048902207 8:139049587-139049609 TCTGCAGTGCGTTTTGCCCCTGG + Intergenic
1050151550 9:2622753-2622775 TCTGAAGCCCGGCCGGCCCCTGG - Intronic
1052512756 9:29442135-29442157 TCTGAAGCCAGGCTTTCCACAGG - Intergenic
1056823351 9:89859997-89860019 TCTGAAGTCAGGCCTCCCCAGGG - Intergenic
1057392238 9:94649561-94649583 TCTGAAGGCCGGGTTCCCCAGGG + Intergenic
1061039605 9:128132286-128132308 TCTGAAGTCAGGCCTCCCCAGGG + Intergenic
1062217196 9:135395643-135395665 TCTGCAGGCAGGGTTGCCCCAGG - Intergenic
1062261520 9:135665401-135665423 TCTGAAGTCCGGCCCAACCCTGG + Intronic
1062469369 9:136695833-136695855 CCTGAAGGCAGGCTTTCCCCAGG - Intergenic
1190413207 X:50156965-50156987 TCTGAAGTCAGCCCTGCCTCTGG + Intergenic
1200048187 X:153413593-153413615 TCTGAAGCCAGGCTTCCCCGAGG - Intergenic