ID: 1039068782

View in Genome Browser
Species Human (GRCh38)
Location 8:33632008-33632030
Sequence GGCGGCGTGGAGCAAGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039068782_1039068789 -1 Left 1039068782 8:33632008-33632030 CCCGCTCCTTGCTCCACGCCGCC No data
Right 1039068789 8:33632030-33632052 CCAGTCCCATCGACCACCCAAGG 0: 641
1: 570
2: 324
3: 264
4: 288
1039068782_1039068790 0 Left 1039068782 8:33632008-33632030 CCCGCTCCTTGCTCCACGCCGCC No data
Right 1039068790 8:33632031-33632053 CAGTCCCATCGACCACCCAAGGG 0: 659
1: 576
2: 339
3: 260
4: 275
1039068782_1039068796 14 Left 1039068782 8:33632008-33632030 CCCGCTCCTTGCTCCACGCCGCC No data
Right 1039068796 8:33632045-33632067 ACCCAAGGGCTGAGGAGTGCGGG 0: 497
1: 663
2: 372
3: 172
4: 320
1039068782_1039068793 6 Left 1039068782 8:33632008-33632030 CCCGCTCCTTGCTCCACGCCGCC No data
Right 1039068793 8:33632037-33632059 CATCGACCACCCAAGGGCTGAGG 0: 672
1: 634
2: 441
3: 258
4: 206
1039068782_1039068799 27 Left 1039068782 8:33632008-33632030 CCCGCTCCTTGCTCCACGCCGCC No data
Right 1039068799 8:33632058-33632080 GGAGTGCGGGCGCACTGCCCAGG No data
1039068782_1039068795 13 Left 1039068782 8:33632008-33632030 CCCGCTCCTTGCTCCACGCCGCC No data
Right 1039068795 8:33632044-33632066 CACCCAAGGGCTGAGGAGTGCGG 0: 455
1: 339
2: 243
3: 121
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039068782 Original CRISPR GGCGGCGTGGAGCAAGGAGC GGG (reversed) Intergenic
No off target data available for this crispr