ID: 1039075365

View in Genome Browser
Species Human (GRCh38)
Location 8:33686035-33686057
Sequence AGAAACTTGGGGGACTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039075365_1039075371 -9 Left 1039075365 8:33686035-33686057 CCATGTCAGTCCCCCAAGTTTCT No data
Right 1039075371 8:33686049-33686071 CAAGTTTCTTTTGTGAAGATGGG No data
1039075365_1039075370 -10 Left 1039075365 8:33686035-33686057 CCATGTCAGTCCCCCAAGTTTCT No data
Right 1039075370 8:33686048-33686070 CCAAGTTTCTTTTGTGAAGATGG No data
1039075365_1039075372 3 Left 1039075365 8:33686035-33686057 CCATGTCAGTCCCCCAAGTTTCT No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039075365 Original CRISPR AGAAACTTGGGGGACTGACA TGG (reversed) Intergenic
No off target data available for this crispr