ID: 1039075366

View in Genome Browser
Species Human (GRCh38)
Location 8:33686045-33686067
Sequence TCTTCACAAAAGAAACTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039075366_1039075376 28 Left 1039075366 8:33686045-33686067 CCCCCAAGTTTCTTTTGTGAAGA No data
Right 1039075376 8:33686096-33686118 CTCTGTTTAAAACCATCACTGGG No data
1039075366_1039075372 -7 Left 1039075366 8:33686045-33686067 CCCCCAAGTTTCTTTTGTGAAGA No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data
1039075366_1039075375 27 Left 1039075366 8:33686045-33686067 CCCCCAAGTTTCTTTTGTGAAGA No data
Right 1039075375 8:33686095-33686117 CCTCTGTTTAAAACCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039075366 Original CRISPR TCTTCACAAAAGAAACTTGG GGG (reversed) Intergenic
No off target data available for this crispr