ID: 1039075368

View in Genome Browser
Species Human (GRCh38)
Location 8:33686047-33686069
Sequence CATCTTCACAAAAGAAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039075368_1039075376 26 Left 1039075368 8:33686047-33686069 CCCAAGTTTCTTTTGTGAAGATG No data
Right 1039075376 8:33686096-33686118 CTCTGTTTAAAACCATCACTGGG No data
1039075368_1039075375 25 Left 1039075368 8:33686047-33686069 CCCAAGTTTCTTTTGTGAAGATG No data
Right 1039075375 8:33686095-33686117 CCTCTGTTTAAAACCATCACTGG No data
1039075368_1039075372 -9 Left 1039075368 8:33686047-33686069 CCCAAGTTTCTTTTGTGAAGATG No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039075368 Original CRISPR CATCTTCACAAAAGAAACTT GGG (reversed) Intergenic
No off target data available for this crispr