ID: 1039075372

View in Genome Browser
Species Human (GRCh38)
Location 8:33686061-33686083
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039075365_1039075372 3 Left 1039075365 8:33686035-33686057 CCATGTCAGTCCCCCAAGTTTCT No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data
1039075368_1039075372 -9 Left 1039075368 8:33686047-33686069 CCCAAGTTTCTTTTGTGAAGATG No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data
1039075369_1039075372 -10 Left 1039075369 8:33686048-33686070 CCAAGTTTCTTTTGTGAAGATGG No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data
1039075367_1039075372 -8 Left 1039075367 8:33686046-33686068 CCCCAAGTTTCTTTTGTGAAGAT No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data
1039075366_1039075372 -7 Left 1039075366 8:33686045-33686067 CCCCCAAGTTTCTTTTGTGAAGA No data
Right 1039075372 8:33686061-33686083 GTGAAGATGGGAGCAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039075372 Original CRISPR GTGAAGATGGGAGCAGCATG TGG Intergenic
No off target data available for this crispr