ID: 1039079212

View in Genome Browser
Species Human (GRCh38)
Location 8:33719408-33719430
Sequence TGTGTAGACGAGGATAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039079212_1039079216 14 Left 1039079212 8:33719408-33719430 CCATCTCTATCCTCGTCTACACA No data
Right 1039079216 8:33719445-33719467 AAGATTCCCAGGAGTTACAAAGG No data
1039079212_1039079215 3 Left 1039079212 8:33719408-33719430 CCATCTCTATCCTCGTCTACACA No data
Right 1039079215 8:33719434-33719456 TTGTGGATGCAAAGATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039079212 Original CRISPR TGTGTAGACGAGGATAGAGA TGG (reversed) Intergenic
No off target data available for this crispr