ID: 1039081418

View in Genome Browser
Species Human (GRCh38)
Location 8:33737644-33737666
Sequence CAGTGCTCTCACCTTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039081415_1039081418 -1 Left 1039081415 8:33737622-33737644 CCTTATTTTAAGCCTTATGCTAC No data
Right 1039081418 8:33737644-33737666 CAGTGCTCTCACCTTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039081418 Original CRISPR CAGTGCTCTCACCTTGAAGG TGG Intergenic
No off target data available for this crispr