ID: 1039086958

View in Genome Browser
Species Human (GRCh38)
Location 8:33789575-33789597
Sequence AGGGTTAAAGTGAAATACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039086958_1039086970 28 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG No data
1039086958_1039086965 4 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086965 8:33789602-33789624 TAAAAGGGCTCAGGGAGCACTGG No data
1039086958_1039086968 13 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086968 8:33789611-33789633 TCAGGGAGCACTGGAATGTGGGG No data
1039086958_1039086969 21 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086969 8:33789619-33789641 CACTGGAATGTGGGGAAAGATGG No data
1039086958_1039086966 11 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086966 8:33789609-33789631 GCTCAGGGAGCACTGGAATGTGG No data
1039086958_1039086967 12 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086967 8:33789610-33789632 CTCAGGGAGCACTGGAATGTGGG No data
1039086958_1039086961 -5 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086961 8:33789593-33789615 ACCCTTAGATAAAAGGGCTCAGG No data
1039086958_1039086972 30 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086972 8:33789628-33789650 GTGGGGAAAGATGGAAGCTGGGG No data
1039086958_1039086971 29 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086971 8:33789627-33789649 TGTGGGGAAAGATGGAAGCTGGG No data
1039086958_1039086963 -4 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086963 8:33789594-33789616 CCCTTAGATAAAAGGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039086958 Original CRISPR AGGGTTAAAGTGAAATACAT TGG (reversed) Intergenic
No off target data available for this crispr