ID: 1039086964

View in Genome Browser
Species Human (GRCh38)
Location 8:33789595-33789617
Sequence TCCCTGAGCCCTTTTATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039086964_1039086974 12 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086974 8:33789630-33789652 GGGGAAAGATGGAAGCTGGGGGG No data
1039086964_1039086967 -8 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086967 8:33789610-33789632 CTCAGGGAGCACTGGAATGTGGG No data
1039086964_1039086972 10 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086972 8:33789628-33789650 GTGGGGAAAGATGGAAGCTGGGG No data
1039086964_1039086971 9 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086971 8:33789627-33789649 TGTGGGGAAAGATGGAAGCTGGG No data
1039086964_1039086969 1 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086969 8:33789619-33789641 CACTGGAATGTGGGGAAAGATGG No data
1039086964_1039086970 8 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG No data
1039086964_1039086968 -7 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086968 8:33789611-33789633 TCAGGGAGCACTGGAATGTGGGG No data
1039086964_1039086966 -9 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086966 8:33789609-33789631 GCTCAGGGAGCACTGGAATGTGG No data
1039086964_1039086973 11 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086973 8:33789629-33789651 TGGGGAAAGATGGAAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039086964 Original CRISPR TCCCTGAGCCCTTTTATCTA AGG (reversed) Intergenic
No off target data available for this crispr