ID: 1039086970

View in Genome Browser
Species Human (GRCh38)
Location 8:33789626-33789648
Sequence ATGTGGGGAAAGATGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039086964_1039086970 8 Left 1039086964 8:33789595-33789617 CCTTAGATAAAAGGGCTCAGGGA No data
Right 1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG No data
1039086958_1039086970 28 Left 1039086958 8:33789575-33789597 CCAATGTATTTCACTTTAACCCT No data
Right 1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG No data
1039086962_1039086970 9 Left 1039086962 8:33789594-33789616 CCCTTAGATAAAAGGGCTCAGGG No data
Right 1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG No data
1039086957_1039086970 29 Left 1039086957 8:33789574-33789596 CCCAATGTATTTCACTTTAACCC No data
Right 1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039086970 Original CRISPR ATGTGGGGAAAGATGGAAGC TGG Intergenic
No off target data available for this crispr