ID: 1039088245

View in Genome Browser
Species Human (GRCh38)
Location 8:33801010-33801032
Sequence TTTCTCAGTGGCCTACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039088245_1039088250 -3 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088250 8:33801030-33801052 AAAGCTGGCTAATTGCAAAGGGG No data
1039088245_1039088256 26 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088256 8:33801059-33801081 TTCAGGGTGGGAAGAGTGAATGG No data
1039088245_1039088252 9 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088252 8:33801042-33801064 TTGCAAAGGGGCTGGATTTCAGG No data
1039088245_1039088248 -5 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088248 8:33801028-33801050 AGAAAGCTGGCTAATTGCAAAGG No data
1039088245_1039088251 1 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088251 8:33801034-33801056 CTGGCTAATTGCAAAGGGGCTGG No data
1039088245_1039088257 27 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088257 8:33801060-33801082 TCAGGGTGGGAAGAGTGAATGGG No data
1039088245_1039088254 13 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088254 8:33801046-33801068 AAAGGGGCTGGATTTCAGGGTGG No data
1039088245_1039088253 10 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088253 8:33801043-33801065 TGCAAAGGGGCTGGATTTCAGGG No data
1039088245_1039088255 14 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088255 8:33801047-33801069 AAGGGGCTGGATTTCAGGGTGGG No data
1039088245_1039088249 -4 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088249 8:33801029-33801051 GAAAGCTGGCTAATTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039088245 Original CRISPR TTTCTCAGTGGCCTACAATT TGG (reversed) Intergenic
No off target data available for this crispr