ID: 1039088248

View in Genome Browser
Species Human (GRCh38)
Location 8:33801028-33801050
Sequence AGAAAGCTGGCTAATTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039088244_1039088248 3 Left 1039088244 8:33801002-33801024 CCTCTTATCCAAATTGTAGGCCA No data
Right 1039088248 8:33801028-33801050 AGAAAGCTGGCTAATTGCAAAGG No data
1039088245_1039088248 -5 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088248 8:33801028-33801050 AGAAAGCTGGCTAATTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039088248 Original CRISPR AGAAAGCTGGCTAATTGCAA AGG Intergenic
No off target data available for this crispr