ID: 1039088254

View in Genome Browser
Species Human (GRCh38)
Location 8:33801046-33801068
Sequence AAAGGGGCTGGATTTCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039088244_1039088254 21 Left 1039088244 8:33801002-33801024 CCTCTTATCCAAATTGTAGGCCA No data
Right 1039088254 8:33801046-33801068 AAAGGGGCTGGATTTCAGGGTGG No data
1039088247_1039088254 1 Left 1039088247 8:33801022-33801044 CCACTGAGAAAGCTGGCTAATTG No data
Right 1039088254 8:33801046-33801068 AAAGGGGCTGGATTTCAGGGTGG No data
1039088245_1039088254 13 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088254 8:33801046-33801068 AAAGGGGCTGGATTTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039088254 Original CRISPR AAAGGGGCTGGATTTCAGGG TGG Intergenic
No off target data available for this crispr