ID: 1039088256

View in Genome Browser
Species Human (GRCh38)
Location 8:33801059-33801081
Sequence TTCAGGGTGGGAAGAGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039088247_1039088256 14 Left 1039088247 8:33801022-33801044 CCACTGAGAAAGCTGGCTAATTG No data
Right 1039088256 8:33801059-33801081 TTCAGGGTGGGAAGAGTGAATGG No data
1039088245_1039088256 26 Left 1039088245 8:33801010-33801032 CCAAATTGTAGGCCACTGAGAAA No data
Right 1039088256 8:33801059-33801081 TTCAGGGTGGGAAGAGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039088256 Original CRISPR TTCAGGGTGGGAAGAGTGAA TGG Intergenic
No off target data available for this crispr