ID: 1039091849

View in Genome Browser
Species Human (GRCh38)
Location 8:33838994-33839016
Sequence CTTTATTTTCAACCTGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039091849_1039091853 11 Left 1039091849 8:33838994-33839016 CCATGATCAGGTTGAAAATAAAG No data
Right 1039091853 8:33839028-33839050 TATAGGCAAATCCAAACCAAAGG No data
1039091849_1039091852 -6 Left 1039091849 8:33838994-33839016 CCATGATCAGGTTGAAAATAAAG No data
Right 1039091852 8:33839011-33839033 ATAAAGGAAAGGAAAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039091849 Original CRISPR CTTTATTTTCAACCTGATCA TGG (reversed) Intergenic
No off target data available for this crispr