ID: 1039095513

View in Genome Browser
Species Human (GRCh38)
Location 8:33880725-33880747
Sequence TTACCACAGCTGATGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039095513_1039095520 4 Left 1039095513 8:33880725-33880747 CCAGAGAGCATCAGCTGTGGTAA No data
Right 1039095520 8:33880752-33880774 GGGAGGAACAGATGCTAGGCGGG No data
1039095513_1039095518 0 Left 1039095513 8:33880725-33880747 CCAGAGAGCATCAGCTGTGGTAA No data
Right 1039095518 8:33880748-33880770 TGTGGGGAGGAACAGATGCTAGG No data
1039095513_1039095519 3 Left 1039095513 8:33880725-33880747 CCAGAGAGCATCAGCTGTGGTAA No data
Right 1039095519 8:33880751-33880773 GGGGAGGAACAGATGCTAGGCGG No data
1039095513_1039095521 5 Left 1039095513 8:33880725-33880747 CCAGAGAGCATCAGCTGTGGTAA No data
Right 1039095521 8:33880753-33880775 GGAGGAACAGATGCTAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039095513 Original CRISPR TTACCACAGCTGATGCTCTC TGG (reversed) Intergenic
No off target data available for this crispr