ID: 1039103747

View in Genome Browser
Species Human (GRCh38)
Location 8:33967925-33967947
Sequence CAGTGGGGATGGAGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039103747_1039103752 -5 Left 1039103747 8:33967925-33967947 CCATCTTGGCTCCATCCCCACTG No data
Right 1039103752 8:33967943-33967965 CACTGATATAATTTTTTAAGTGG No data
1039103747_1039103753 12 Left 1039103747 8:33967925-33967947 CCATCTTGGCTCCATCCCCACTG No data
Right 1039103753 8:33967960-33967982 AAGTGGTGACTTATATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039103747 Original CRISPR CAGTGGGGATGGAGCCAAGA TGG (reversed) Intergenic
No off target data available for this crispr