ID: 1039105065

View in Genome Browser
Species Human (GRCh38)
Location 8:33981289-33981311
Sequence CGTCACTGTGAAGTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039105060_1039105065 22 Left 1039105060 8:33981244-33981266 CCTTATGGGTTTGAGTCTTGCTC No data
Right 1039105065 8:33981289-33981311 CGTCACTGTGAAGTGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039105065 Original CRISPR CGTCACTGTGAAGTGTGATG GGG Intergenic
No off target data available for this crispr