ID: 1039105265

View in Genome Browser
Species Human (GRCh38)
Location 8:33982992-33983014
Sequence TGCACACTGGCAGCCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039105265_1039105270 19 Left 1039105265 8:33982992-33983014 CCACTTTGGGCTGCCAGTGTGCA No data
Right 1039105270 8:33983034-33983056 ATGTGAGCCCTGAGGTTGAACGG No data
1039105265_1039105268 -4 Left 1039105265 8:33982992-33983014 CCACTTTGGGCTGCCAGTGTGCA No data
Right 1039105268 8:33983011-33983033 TGCAGCTTCTAAAAGGAGAAAGG No data
1039105265_1039105269 11 Left 1039105265 8:33982992-33983014 CCACTTTGGGCTGCCAGTGTGCA No data
Right 1039105269 8:33983026-33983048 GAGAAAGGATGTGAGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039105265 Original CRISPR TGCACACTGGCAGCCCAAAG TGG (reversed) Intergenic
No off target data available for this crispr