ID: 1039110895

View in Genome Browser
Species Human (GRCh38)
Location 8:34039790-34039812
Sequence CTGAATGTTCACAAAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039110895_1039110897 27 Left 1039110895 8:34039790-34039812 CCTGGCCTTTTGTGAACATTCAG No data
Right 1039110897 8:34039840-34039862 TACTTTTCCACTTGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039110895 Original CRISPR CTGAATGTTCACAAAAGGCC AGG (reversed) Intergenic
No off target data available for this crispr