ID: 1039111086

View in Genome Browser
Species Human (GRCh38)
Location 8:34041189-34041211
Sequence GAGTTAGATGCCCCTCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039111086_1039111094 24 Left 1039111086 8:34041189-34041211 CCCATAGGAGGGGCATCTAACTC No data
Right 1039111094 8:34041236-34041258 ATCCCATCACATGTGAAGGCTGG No data
1039111086_1039111095 25 Left 1039111086 8:34041189-34041211 CCCATAGGAGGGGCATCTAACTC No data
Right 1039111095 8:34041237-34041259 TCCCATCACATGTGAAGGCTGGG No data
1039111086_1039111093 20 Left 1039111086 8:34041189-34041211 CCCATAGGAGGGGCATCTAACTC No data
Right 1039111093 8:34041232-34041254 TAAGATCCCATCACATGTGAAGG No data
1039111086_1039111090 -4 Left 1039111086 8:34041189-34041211 CCCATAGGAGGGGCATCTAACTC No data
Right 1039111090 8:34041208-34041230 ACTCCCAGGCAGGTCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039111086 Original CRISPR GAGTTAGATGCCCCTCCTAT GGG (reversed) Intergenic
No off target data available for this crispr