ID: 1039113853

View in Genome Browser
Species Human (GRCh38)
Location 8:34070478-34070500
Sequence CTCTTTCCATGTGTTCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039113853_1039113856 10 Left 1039113853 8:34070478-34070500 CCTAAGGGAACACATGGAAAGAG No data
Right 1039113856 8:34070511-34070533 CTCACTTAAACACAAGAGCAGGG No data
1039113853_1039113858 19 Left 1039113853 8:34070478-34070500 CCTAAGGGAACACATGGAAAGAG No data
Right 1039113858 8:34070520-34070542 ACACAAGAGCAGGGTTGGAGAGG No data
1039113853_1039113855 9 Left 1039113853 8:34070478-34070500 CCTAAGGGAACACATGGAAAGAG No data
Right 1039113855 8:34070510-34070532 TCTCACTTAAACACAAGAGCAGG No data
1039113853_1039113857 14 Left 1039113853 8:34070478-34070500 CCTAAGGGAACACATGGAAAGAG No data
Right 1039113857 8:34070515-34070537 CTTAAACACAAGAGCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039113853 Original CRISPR CTCTTTCCATGTGTTCCCTT AGG (reversed) Intergenic
No off target data available for this crispr