ID: 1039113857

View in Genome Browser
Species Human (GRCh38)
Location 8:34070515-34070537
Sequence CTTAAACACAAGAGCAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039113853_1039113857 14 Left 1039113853 8:34070478-34070500 CCTAAGGGAACACATGGAAAGAG No data
Right 1039113857 8:34070515-34070537 CTTAAACACAAGAGCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039113857 Original CRISPR CTTAAACACAAGAGCAGGGT TGG Intergenic
No off target data available for this crispr