ID: 1039114595

View in Genome Browser
Species Human (GRCh38)
Location 8:34078543-34078565
Sequence CTTCACACTGTCACTGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039114595_1039114599 25 Left 1039114595 8:34078543-34078565 CCAGAGACAGTGACAGTGTGAAG No data
Right 1039114599 8:34078591-34078613 TCCTTGCCATGTAGTCATGGTGG No data
1039114595_1039114597 22 Left 1039114595 8:34078543-34078565 CCAGAGACAGTGACAGTGTGAAG No data
Right 1039114597 8:34078588-34078610 ACCTCCTTGCCATGTAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039114595 Original CRISPR CTTCACACTGTCACTGTCTC TGG (reversed) Intergenic