ID: 1039114599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:34078591-34078613 |
| Sequence | TCCTTGCCATGTAGTCATGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039114596_1039114599 | 2 | Left | 1039114596 | 8:34078566-34078588 | CCATAACAGACAGCACAACTGTA | No data | ||
| Right | 1039114599 | 8:34078591-34078613 | TCCTTGCCATGTAGTCATGGTGG | No data | ||||
| 1039114595_1039114599 | 25 | Left | 1039114595 | 8:34078543-34078565 | CCAGAGACAGTGACAGTGTGAAG | 0: 1 1: 0 2: 1 3: 24 4: 231 |
||
| Right | 1039114599 | 8:34078591-34078613 | TCCTTGCCATGTAGTCATGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039114599 | Original CRISPR | TCCTTGCCATGTAGTCATGG TGG | Intergenic | ||