ID: 1039114599

View in Genome Browser
Species Human (GRCh38)
Location 8:34078591-34078613
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039114595_1039114599 25 Left 1039114595 8:34078543-34078565 CCAGAGACAGTGACAGTGTGAAG No data
Right 1039114599 8:34078591-34078613 TCCTTGCCATGTAGTCATGGTGG No data
1039114596_1039114599 2 Left 1039114596 8:34078566-34078588 CCATAACAGACAGCACAACTGTA No data
Right 1039114599 8:34078591-34078613 TCCTTGCCATGTAGTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039114599 Original CRISPR TCCTTGCCATGTAGTCATGG TGG Intergenic