ID: 1039117769

View in Genome Browser
Species Human (GRCh38)
Location 8:34111839-34111861
Sequence CAGAGCTGTCTCATTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039117762_1039117769 13 Left 1039117762 8:34111803-34111825 CCAGAAACAATGGGAGACAGGAA No data
Right 1039117769 8:34111839-34111861 CAGAGCTGTCTCATTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039117769 Original CRISPR CAGAGCTGTCTCATTGCACC TGG Intergenic
No off target data available for this crispr