ID: 1039120682

View in Genome Browser
Species Human (GRCh38)
Location 8:34142826-34142848
Sequence ACGCACTCCAAGCAGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039120675_1039120682 20 Left 1039120675 8:34142783-34142805 CCCATCCAGAGGTTCCACACTGC No data
Right 1039120682 8:34142826-34142848 ACGCACTCCAAGCAGGGCAATGG No data
1039120674_1039120682 26 Left 1039120674 8:34142777-34142799 CCTGAGCCCATCCAGAGGTTCCA No data
Right 1039120682 8:34142826-34142848 ACGCACTCCAAGCAGGGCAATGG No data
1039120678_1039120682 6 Left 1039120678 8:34142797-34142819 CCACACTGCAGTGAGCTATGATG No data
Right 1039120682 8:34142826-34142848 ACGCACTCCAAGCAGGGCAATGG No data
1039120676_1039120682 19 Left 1039120676 8:34142784-34142806 CCATCCAGAGGTTCCACACTGCA No data
Right 1039120682 8:34142826-34142848 ACGCACTCCAAGCAGGGCAATGG No data
1039120677_1039120682 15 Left 1039120677 8:34142788-34142810 CCAGAGGTTCCACACTGCAGTGA No data
Right 1039120682 8:34142826-34142848 ACGCACTCCAAGCAGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039120682 Original CRISPR ACGCACTCCAAGCAGGGCAA TGG Intergenic
No off target data available for this crispr