ID: 1039131989

View in Genome Browser
Species Human (GRCh38)
Location 8:34275593-34275615
Sequence CTCCTTGGGAACCAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039131980_1039131989 9 Left 1039131980 8:34275561-34275583 CCTTGCTAGAACAGAAACCCATG No data
Right 1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG No data
1039131983_1039131989 -9 Left 1039131983 8:34275579-34275601 CCATGAGCAGCAACCTCCTTGGG No data
Right 1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG No data
1039131981_1039131989 -8 Left 1039131981 8:34275578-34275600 CCCATGAGCAGCAACCTCCTTGG No data
Right 1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039131989 Original CRISPR CTCCTTGGGAACCAGGGCCA GGG Intergenic
No off target data available for this crispr