ID: 1039135782

View in Genome Browser
Species Human (GRCh38)
Location 8:34321336-34321358
Sequence AACTCACTCATTGTGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039135782_1039135783 8 Left 1039135782 8:34321336-34321358 CCTGGGATCACAATGAGTGAGTT No data
Right 1039135783 8:34321367-34321389 ATCTGATTGTTTAAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039135782 Original CRISPR AACTCACTCATTGTGATCCC AGG (reversed) Intergenic
No off target data available for this crispr