ID: 1039135783

View in Genome Browser
Species Human (GRCh38)
Location 8:34321367-34321389
Sequence ATCTGATTGTTTAAAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039135782_1039135783 8 Left 1039135782 8:34321336-34321358 CCTGGGATCACAATGAGTGAGTT No data
Right 1039135783 8:34321367-34321389 ATCTGATTGTTTAAAGTGTGTGG No data
1039135779_1039135783 20 Left 1039135779 8:34321324-34321346 CCCACTGTGATCCCTGGGATCAC No data
Right 1039135783 8:34321367-34321389 ATCTGATTGTTTAAAGTGTGTGG No data
1039135781_1039135783 9 Left 1039135781 8:34321335-34321357 CCCTGGGATCACAATGAGTGAGT No data
Right 1039135783 8:34321367-34321389 ATCTGATTGTTTAAAGTGTGTGG No data
1039135780_1039135783 19 Left 1039135780 8:34321325-34321347 CCACTGTGATCCCTGGGATCACA No data
Right 1039135783 8:34321367-34321389 ATCTGATTGTTTAAAGTGTGTGG No data
1039135775_1039135783 27 Left 1039135775 8:34321317-34321339 CCATGACCCCACTGTGATCCCTG No data
Right 1039135783 8:34321367-34321389 ATCTGATTGTTTAAAGTGTGTGG No data
1039135778_1039135783 21 Left 1039135778 8:34321323-34321345 CCCCACTGTGATCCCTGGGATCA No data
Right 1039135783 8:34321367-34321389 ATCTGATTGTTTAAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039135783 Original CRISPR ATCTGATTGTTTAAAGTGTG TGG Intergenic
No off target data available for this crispr