ID: 1039138445

View in Genome Browser
Species Human (GRCh38)
Location 8:34355100-34355122
Sequence GCCATTGTGGAAAGCAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039138445_1039138449 7 Left 1039138445 8:34355100-34355122 CCCAAACTGCTTTCCACAATGGC No data
Right 1039138449 8:34355130-34355152 GTTTATATTCCCACCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039138445 Original CRISPR GCCATTGTGGAAAGCAGTTT GGG (reversed) Intergenic