ID: 1039138446

View in Genome Browser
Species Human (GRCh38)
Location 8:34355101-34355123
Sequence AGCCATTGTGGAAAGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039138446_1039138449 6 Left 1039138446 8:34355101-34355123 CCAAACTGCTTTCCACAATGGCT No data
Right 1039138449 8:34355130-34355152 GTTTATATTCCCACCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039138446 Original CRISPR AGCCATTGTGGAAAGCAGTT TGG (reversed) Intergenic