ID: 1039138449

View in Genome Browser
Species Human (GRCh38)
Location 8:34355130-34355152
Sequence GTTTATATTCCCACCAGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039138446_1039138449 6 Left 1039138446 8:34355101-34355123 CCAAACTGCTTTCCACAATGGCT No data
Right 1039138449 8:34355130-34355152 GTTTATATTCCCACCAGTAGTGG No data
1039138445_1039138449 7 Left 1039138445 8:34355100-34355122 CCCAAACTGCTTTCCACAATGGC No data
Right 1039138449 8:34355130-34355152 GTTTATATTCCCACCAGTAGTGG No data
1039138443_1039138449 8 Left 1039138443 8:34355099-34355121 CCCCAAACTGCTTTCCACAATGG No data
Right 1039138449 8:34355130-34355152 GTTTATATTCCCACCAGTAGTGG No data
1039138447_1039138449 -6 Left 1039138447 8:34355113-34355135 CCACAATGGCTGACCTAGTTTAT No data
Right 1039138449 8:34355130-34355152 GTTTATATTCCCACCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039138449 Original CRISPR GTTTATATTCCCACCAGTAG TGG Intergenic