ID: 1039138450

View in Genome Browser
Species Human (GRCh38)
Location 8:34355139-34355161
Sequence TAGGCTTGTCCACTACTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039138450_1039138454 3 Left 1039138450 8:34355139-34355161 CCCACCAGTAGTGGACAAGCCTA No data
Right 1039138454 8:34355165-34355187 GTTCCCTTTTTTTCACAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039138450 Original CRISPR TAGGCTTGTCCACTACTGGT GGG (reversed) Intergenic