ID: 1039138454

View in Genome Browser
Species Human (GRCh38)
Location 8:34355165-34355187
Sequence GTTCCCTTTTTTTCACAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039138451_1039138454 2 Left 1039138451 8:34355140-34355162 CCACCAGTAGTGGACAAGCCTAA No data
Right 1039138454 8:34355165-34355187 GTTCCCTTTTTTTCACAACCTGG No data
1039138450_1039138454 3 Left 1039138450 8:34355139-34355161 CCCACCAGTAGTGGACAAGCCTA No data
Right 1039138454 8:34355165-34355187 GTTCCCTTTTTTTCACAACCTGG No data
1039138447_1039138454 29 Left 1039138447 8:34355113-34355135 CCACAATGGCTGACCTAGTTTAT No data
Right 1039138454 8:34355165-34355187 GTTCCCTTTTTTTCACAACCTGG No data
1039138452_1039138454 -1 Left 1039138452 8:34355143-34355165 CCAGTAGTGGACAAGCCTAAATG No data
Right 1039138454 8:34355165-34355187 GTTCCCTTTTTTTCACAACCTGG No data
1039138448_1039138454 16 Left 1039138448 8:34355126-34355148 CCTAGTTTATATTCCCACCAGTA No data
Right 1039138454 8:34355165-34355187 GTTCCCTTTTTTTCACAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039138454 Original CRISPR GTTCCCTTTTTTTCACAACC TGG Intergenic