ID: 1039139729

View in Genome Browser
Species Human (GRCh38)
Location 8:34373073-34373095
Sequence ATTAGATCTCAGGGGACCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039139729_1039139736 24 Left 1039139729 8:34373073-34373095 CCGTTGGTCCCCTGAGATCTAAT No data
Right 1039139736 8:34373120-34373142 TAATTACAATGCTTTGAGGGTGG No data
1039139729_1039139734 20 Left 1039139729 8:34373073-34373095 CCGTTGGTCCCCTGAGATCTAAT No data
Right 1039139734 8:34373116-34373138 ATACTAATTACAATGCTTTGAGG No data
1039139729_1039139735 21 Left 1039139729 8:34373073-34373095 CCGTTGGTCCCCTGAGATCTAAT No data
Right 1039139735 8:34373117-34373139 TACTAATTACAATGCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039139729 Original CRISPR ATTAGATCTCAGGGGACCAA CGG (reversed) Intergenic
No off target data available for this crispr